Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100781807:

Variant ID: vg1100781807 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 781807
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

TACCATTAATGTATTATTTAGAATTTCAAGTATTTTGCGTGATACAGAAATAACTGCCAAACTTACTCAGAATCACTTTTCCATATCCAGCACTGCATTG[A/G]
CATTGCAACATATGTATCTACCACATAGGATTTCTAATTTGAGATATTAACTAGAAAAAATGCCCGTGTGTTGCAACGGGTGAAGTCTATTTTAATCTTA

Reverse complement sequence

TAAGATTAAAATAGACTTCACCCGTTGCAACACACGGGCATTTTTTCTAGTTAATATCTCAAATTAGAAATCCTATGTGGTAGATACATATGTTGCAATG[T/C]
CAATGCAGTGCTGGATATGGAAAAGTGATTCTGAGTAAGTTTGGCAGTTATTTCTGTATCACGCAAAATACTTGAAATTCTAAATAATACATTAATGGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.40%	40.20%	0.36%	0.00%	NA
All Indica	2759	95.50%	4.00%	0.47%	0.00%	NA
All Japonica	1512	2.20%	97.70%	0.13%	0.00%	NA
Aus	269	36.10%	63.90%	0.00%	0.00%	NA
Indica I	595	98.30%	0.70%	1.01%	0.00%	NA
Indica II	465	86.90%	12.50%	0.65%	0.00%	NA
Indica III	913	99.00%	1.00%	0.00%	0.00%	NA
Indica Intermediate	786	94.50%	5.00%	0.51%	0.00%	NA
Temperate Japonica	767	2.60%	97.40%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	3.70%	95.40%	0.83%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	38.90%	58.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1100781807	A -> G	LOC_Os11g02500.1	downstream_gene_variant ; 4238.0bp to feature; MODIFIER	silent_mutation	Average:47.122; most accessible tissue: Callus, score: 67.624	N	N	N	N
vg1100781807	A -> G	LOC_Os11g02510.1	downstream_gene_variant ; 3045.0bp to feature; MODIFIER	silent_mutation	Average:47.122; most accessible tissue: Callus, score: 67.624	N	N	N	N
vg1100781807	A -> G	LOC_Os11g02520.1	downstream_gene_variant ; 551.0bp to feature; MODIFIER	silent_mutation	Average:47.122; most accessible tissue: Callus, score: 67.624	N	N	N	N
vg1100781807	A -> G	LOC_Os11g02510-LOC_Os11g02520	intergenic_region ; MODIFIER	silent_mutation	Average:47.122; most accessible tissue: Callus, score: 67.624	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1100781807	NA	4.26E-15	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807	NA	6.79E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807	NA	5.07E-08	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807	1.55E-06	3.30E-28	mr1298	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807	NA	1.13E-12	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807	NA	1.91E-51	mr1558	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807	NA	1.47E-19	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807	1.42E-06	NA	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807	NA	9.87E-14	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807	NA	6.96E-17	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807	NA	2.37E-44	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100781807	NA	4.42E-56	mr1558_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251