Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100109327:

Variant ID: vg1100109327 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 109327
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, G: 0.27, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

ACATATATAAAGATCCCATCTCTTGGAAAAAAAGTTAATTGCACAATGGCTAGGTATATTTACAAAAGTTTCATATTGGATCACTCTTTAGCAAATGTTT[T/G]
TACTTCGGGTTAGGTAATCTTACCTCTAGTGTAATTTAGACTTGTTATCTCCATCTTTTCATCTCTCTCACCTCTGGCTTCCTATATTTGCCACCATCAT

Reverse complement sequence

ATGATGGTGGCAAATATAGGAAGCCAGAGGTGAGAGAGATGAAAAGATGGAGATAACAAGTCTAAATTACACTAGAGGTAAGATTACCTAACCCGAAGTA[A/C]
AAACATTTGCTAAAGAGTGATCCAATATGAAACTTTTGTAAATATACCTAGCCATTGTGCAATTAACTTTTTTTCCAAGAGATGGGATCTTTATATATGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.70%	43.50%	0.44%	0.36%	NA
All Indica	2759	86.70%	12.40%	0.47%	0.40%	NA
All Japonica	1512	1.50%	97.60%	0.53%	0.33%	NA
Aus	269	67.30%	32.70%	0.00%	0.00%	NA
Indica I	595	96.80%	1.70%	0.67%	0.84%	NA
Indica II	465	54.20%	44.90%	0.43%	0.43%	NA
Indica III	913	95.20%	4.50%	0.11%	0.22%	NA
Indica Intermediate	786	88.40%	10.60%	0.76%	0.25%	NA
Temperate Japonica	767	1.40%	96.90%	1.04%	0.65%	NA
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	13.50%	86.50%	0.00%	0.00%	NA
Intermediate	90	26.70%	72.20%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1100109327	T -> DEL	N	N	silent_mutation	Average:72.381; most accessible tissue: Minghui63 panicle, score: 87.238	N	N	N	N
vg1100109327	T -> G	LOC_Os11g01180.1	upstream_gene_variant ; 1117.0bp to feature; MODIFIER	silent_mutation	Average:72.381; most accessible tissue: Minghui63 panicle, score: 87.238	N	N	N	N
vg1100109327	T -> G	LOC_Os11g01180-LOC_Os11g01200	intergenic_region ; MODIFIER	silent_mutation	Average:72.381; most accessible tissue: Minghui63 panicle, score: 87.238	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1100109327	NA	7.30E-09	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327	NA	2.14E-10	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327	NA	2.63E-12	mr1907	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327	NA	3.98E-10	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327	NA	1.98E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327	4.78E-07	2.21E-14	mr1889_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327	NA	2.80E-09	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327	NA	1.63E-12	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327	2.28E-07	9.84E-15	mr1907_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1100109327	NA	2.41E-11	mr1934_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251