| Variant ID: vg1022610045 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 22610045 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CAGGTGTCGGGTTTTCCAAGTCTCTTGTAAAACCCAAGTTTTACCCAAGTTGTTTTTCAGATTTTAAGTTTGAAGGCGTCCGTCGATACTCGCACTGGGT[A/G]
CACGAATATCGAGACGCAACTAGATGGTTGCAAGGGGGCATGGTATCACAATTAACAAAGGAAGGATCAAATGCAACAAATTAGGTAGATCTGCCAATCT
AGATTGGCAGATCTACCTAATTTGTTGCATTTGATCCTTCCTTTGTTAATTGTGATACCATGCCCCCTTGCAACCATCTAGTTGCGTCTCGATATTCGTG[T/C]
ACCCAGTGCGAGTATCGACGGACGCCTTCAAACTTAAAATCTGAAAAACAACTTGGGTAAAACTTGGGTTTTACAAGAGACTTGGAAAACCCGACACCTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 19.30% | 0.10% | 19.55% | 61.05% | NA |
| All Indica | 2759 | 4.00% | 0.00% | 3.12% | 92.86% | NA |
| All Japonica | 1512 | 43.90% | 0.30% | 54.03% | 1.72% | NA |
| Aus | 269 | 9.70% | 0.00% | 0.74% | 89.59% | NA |
| Indica I | 595 | 5.50% | 0.00% | 7.06% | 87.39% | NA |
| Indica II | 465 | 3.20% | 0.00% | 1.51% | 95.27% | NA |
| Indica III | 913 | 2.20% | 0.00% | 2.30% | 95.51% | NA |
| Indica Intermediate | 786 | 5.50% | 0.00% | 2.04% | 92.49% | NA |
| Temperate Japonica | 767 | 50.10% | 0.50% | 48.11% | 1.30% | NA |
| Tropical Japonica | 504 | 43.10% | 0.20% | 54.17% | 2.58% | NA |
| Japonica Intermediate | 241 | 26.10% | 0.00% | 72.61% | 1.24% | NA |
| VI/Aromatic | 96 | 79.20% | 0.00% | 8.33% | 12.50% | NA |
| Intermediate | 90 | 38.90% | 0.00% | 12.22% | 48.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1022610045 | A -> G | LOC_Os10g42050.1 | upstream_gene_variant ; 4302.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1022610045 | A -> G | LOC_Os10g42040.1 | downstream_gene_variant ; 1343.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1022610045 | A -> G | LOC_Os10g42040-LOC_Os10g42050 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1022610045 | A -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1022610045 | NA | 8.20E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022610045 | 2.82E-06 | 9.14E-07 | mr1216 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022610045 | NA | 2.04E-06 | mr1060_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022610045 | NA | 3.64E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022610045 | NA | 1.28E-06 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1022610045 | NA | 7.52E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |