Variant ID: vg1021737816 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 21737816 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTAAATTTTTAAACTTGATTTTGAAGTTAATTTTGAAATGCTTTTAACATAATTTTTGTTAATGTTGGCTTTTAAGTCGCTACGAACAAATCTACAAAA[G/A]
TTTTACTTATAAATTAATTTTAATTTTCTAATAAGCCAAATAAGCCATTTTGGGCCAAATGGGCAACCGATGAGAGCCTTCTTATCTCGATTTAGAGGAT
ATCCTCTAAATCGAGATAAGAAGGCTCTCATCGGTTGCCCATTTGGCCCAAAATGGCTTATTTGGCTTATTAGAAAATTAAAATTAATTTATAAGTAAAA[C/T]
TTTTGTAGATTTGTTCGTAGCGACTTAAAAGCCAACATTAACAAAAATTATGTTAAAAGCATTTCAAAATTAACTTCAAAATCAAGTTTAAAAATTTAAA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.70% | 7.30% | 0.06% | 0.00% | NA |
All Indica | 2759 | 97.10% | 2.80% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 8.20% | 91.40% | 0.37% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 94.70% | 5.10% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1021737816 | G -> A | LOC_Os10g40580.1 | downstream_gene_variant ; 806.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
vg1021737816 | G -> A | LOC_Os10g40584.1 | downstream_gene_variant ; 4458.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
vg1021737816 | G -> A | LOC_Os10g40580-LOC_Os10g40584 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1021737816 | NA | 3.42E-14 | mr1166 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1021737816 | NA | 5.03E-23 | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1021737816 | 2.59E-06 | 3.65E-07 | mr1216 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1021737816 | NA | 6.82E-24 | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1021737816 | NA | 2.88E-19 | mr1515 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1021737816 | NA | 1.24E-07 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1021737816 | NA | 5.73E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1021737816 | NA | 9.82E-22 | mr1817 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1021737816 | NA | 4.73E-12 | mr1897 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1021737816 | NA | 1.77E-06 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1021737816 | NA | 1.07E-14 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |