Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020611889:

Variant ID: vg1020611889 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 20611889
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGATTTGAGACCTAGATGACACAGTATGACAAGTTTTGTGACTTAGATATGCATTTTGAGAGTTTAGGGACCTATATGATACACTCCTACAAGTTTAAG[A/G]
ACCGCCTGTGCACTTGTAACGCTCCGCTTCTCGTGGGACGTTAAAAACTAATTCGGCAAAATCCTATATGCGAAAATTTCGTTTTTTGTGTGCGAGTCTA

Reverse complement sequence

TAGACTCGCACACAAAAAACGAAATTTTCGCATATAGGATTTTGCCGAATTAGTTTTTAACGTCCCACGAGAAGCGGAGCGTTACAAGTGCACAGGCGGT[T/C]
CTTAAACTTGTAGGAGTGTATCATATAGGTCCCTAAACTCTCAAAATGCATATCTAAGTCACAAAACTTGTCATACTGTGTCATCTAGGTCTCAAATCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.10% 33.60% 0.23% 0.00% NA
All Indica  2759 97.80% 2.00% 0.25% 0.00% NA
All Japonica  1512 8.70% 91.30% 0.00% 0.00% NA
Aus  269 56.50% 43.10% 0.37% 0.00% NA
Indica I  595 96.60% 2.90% 0.50% 0.00% NA
Indica II  465 98.50% 0.90% 0.65% 0.00% NA
Indica III  913 98.00% 1.90% 0.11% 0.00% NA
Indica Intermediate  786 97.80% 2.20% 0.00% 0.00% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 19.60% 80.40% 0.00% 0.00% NA
Japonica Intermediate  241 6.60% 93.40% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 6.20% 3.12% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1020611889 A -> G LOC_Os10g38690.1 upstream_gene_variant ; 4924.0bp to feature; MODIFIER silent_mutation Average:31.206; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg1020611889 A -> G LOC_Os10g38660.1 downstream_gene_variant ; 3429.0bp to feature; MODIFIER silent_mutation Average:31.206; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg1020611889 A -> G LOC_Os10g38664.1 downstream_gene_variant ; 2272.0bp to feature; MODIFIER silent_mutation Average:31.206; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg1020611889 A -> G LOC_Os10g38670.1 downstream_gene_variant ; 553.0bp to feature; MODIFIER silent_mutation Average:31.206; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg1020611889 A -> G LOC_Os10g38680.1 intron_variant ; MODIFIER silent_mutation Average:31.206; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1020611889 NA 9.94E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 6.10E-08 2.71E-49 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 NA 7.29E-08 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 4.41E-10 7.16E-62 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 NA 2.68E-07 mr1558 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 NA 1.28E-11 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 NA 1.10E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 NA 2.42E-24 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 NA 1.26E-07 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 2.35E-07 1.72E-53 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 NA 1.83E-08 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 1.21E-14 6.41E-86 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 1.27E-06 1.13E-12 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 NA 8.56E-19 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 NA 8.91E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 NA 8.46E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 NA 1.33E-19 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 NA 2.53E-20 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 NA 2.11E-11 mr1805_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 NA 7.15E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020611889 NA 4.82E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251