Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020380304:

Variant ID: vg1020380304 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 20380304
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

CAATATGCTCCGCCCAAAGAGACATTCTGTACCCATAAATCTACACATGAAATCAGCAGATTTGAATTAGAGTGTGGTTCTAGAAATATCAGTCATCCTA[A/C]
AATAGGTATATCCCTCAAACCAAGAGACAACTAGTCGAGATTCCTTCACAGTTGTACAGGGCTATTTGAAATATGACTGTACTTGATATGCAACTTTTTC

Reverse complement sequence

GAAAAAGTTGCATATCAAGTACAGTCATATTTCAAATAGCCCTGTACAACTGTGAAGGAATCTCGACTAGTTGTCTCTTGGTTTGAGGGATATACCTATT[T/G]
TAGGATGACTGATATTTCTAGAACCACACTCTAATTCAAATCTGCTGATTTCATGTGTAGATTTATGGGTACAGAATGTCTCTTTGGGCGGAGCATATTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.40%	27.40%	0.19%	0.00%	NA
All Indica	2759	99.20%	0.80%	0.07%	0.00%	NA
All Japonica	1512	17.30%	82.30%	0.40%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.20%	1.70%	0.17%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.60%	0.13%	0.00%	NA
Temperate Japonica	767	10.40%	88.90%	0.65%	0.00%	NA
Tropical Japonica	504	28.60%	71.20%	0.20%	0.00%	NA
Japonica Intermediate	241	15.80%	84.20%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	70.00%	28.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1020380304	A -> C	LOC_Os10g38040.1	downstream_gene_variant ; 4849.0bp to feature; MODIFIER	silent_mutation	Average:56.17; most accessible tissue: Callus, score: 85.645	N	N	N	N
vg1020380304	A -> C	LOC_Os10g38050.1	downstream_gene_variant ; 69.0bp to feature; MODIFIER	silent_mutation	Average:56.17; most accessible tissue: Callus, score: 85.645	N	N	N	N
vg1020380304	A -> C	LOC_Os10g38060.1	intron_variant ; MODIFIER	silent_mutation	Average:56.17; most accessible tissue: Callus, score: 85.645	N	N	N	N
vg1020380304	A -> C	LOC_Os10g38060.2	intron_variant ; MODIFIER	silent_mutation	Average:56.17; most accessible tissue: Callus, score: 85.645	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1020380304	3.63E-07	NA	mr1057	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304	NA	7.42E-15	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304	NA	1.00E-09	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304	NA	4.26E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304	4.28E-08	NA	mr1057_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304	NA	3.20E-15	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304	NA	1.08E-13	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304	NA	3.78E-07	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304	NA	1.66E-12	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020380304	NA	5.88E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251