Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1020235270:

Variant ID: vg1020235270 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 20235270
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGCCATTGATAACTTGGGTATCAAAATGACTAGATGTTGGCTTAGGAAATGCTTAGCCATGCTTAGTTCAACTAGTACACAAATGGGATCACATTATTA[C/T]
ATAGACTCTGACTATTGGCATAGCTTTAGATTGGTGCCACCGCAAGGGTGTCAGTTAATTAAAATATTCTGAATGGCGGGCTGTGAGTGCATGGTTTTGC

Reverse complement sequence

GCAAAACCATGCACTCACAGCCCGCCATTCAGAATATTTTAATTAACTGACACCCTTGCGGTGGCACCAATCTAAAGCTATGCCAATAGTCAGAGTCTAT[G/A]
TAATAATGTGATCCCATTTGTGTACTAGTTGAACTAAGCATGGCTAAGCATTTCCTAAGCCAACATCTAGTCATTTTGATACCCAAGTTATCAATGGCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.40%	0.10%	21.31%	46.11%	NA
All Indica	2759	5.60%	0.30%	27.84%	66.33%	NA
All Japonica	1512	88.20%	0.00%	1.39%	10.45%	NA
Aus	269	1.50%	0.00%	46.84%	51.67%	NA
Indica I	595	9.40%	0.30%	16.64%	73.61%	NA
Indica II	465	5.20%	0.40%	35.70%	58.71%	NA
Indica III	913	2.40%	0.10%	29.03%	68.46%	NA
Indica Intermediate	786	6.60%	0.30%	30.28%	62.85%	NA
Temperate Japonica	767	97.70%	0.00%	0.78%	1.56%	NA
Tropical Japonica	504	71.40%	0.00%	1.59%	26.98%	NA
Japonica Intermediate	241	92.90%	0.00%	2.90%	4.15%	NA
VI/Aromatic	96	6.20%	0.00%	72.92%	20.83%	NA
Intermediate	90	40.00%	0.00%	24.44%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1020235270	C -> T	LOC_Os10g37800.1	upstream_gene_variant ; 3689.0bp to feature; MODIFIER	silent_mutation	Average:6.957; most accessible tissue: Minghui63 young leaf, score: 12.713	N	N	N	N
vg1020235270	C -> T	LOC_Os10g37810.1	upstream_gene_variant ; 112.0bp to feature; MODIFIER	silent_mutation	Average:6.957; most accessible tissue: Minghui63 young leaf, score: 12.713	N	N	N	N
vg1020235270	C -> T	LOC_Os10g37800-LOC_Os10g37810	intergenic_region ; MODIFIER	silent_mutation	Average:6.957; most accessible tissue: Minghui63 young leaf, score: 12.713	N	N	N	N
vg1020235270	C -> DEL	N	N	silent_mutation	Average:6.957; most accessible tissue: Minghui63 young leaf, score: 12.713	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1020235270	NA	8.05E-06	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020235270	2.62E-06	2.62E-06	mr1791	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1020235270	NA	3.16E-06	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251