Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018945910:

Variant ID: vg1018945910 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 18945910
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, C: 0.18, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


GTTCCCAGGCCGGCCGCACTATTGGGCCACCCCATAGGCCATGTGTACGCTCCGCACAGAATAATTTCGCTTTAGCTCCCTTAATTTGTCCCCTCAAACT[C/T]
CTAAAACCAGTGCAAATCTTTAATTTTTAGTTCACCCATTGCAACTCACGGGCATATTTGCTAGTGACATATAATATGAAACGAAGGATGTAGCAGACTA

Reverse complement sequence

TAGTCTGCTACATCCTTCGTTTCATATTATATGTCACTAGCAAATATGCCCGTGAGTTGCAATGGGTGAACTAAAAATTAAAGATTTGCACTGGTTTTAG[G/A]
AGTTTGAGGGGACAAATTAAGGGAGCTAAAGCGAAATTATTCTGTGCGGAGCGTACACATGGCCTATGGGGTGGCCCAATAGTGCGGCCGGCCTGGGAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.70% 30.40% 0.66% 0.17% NA
All Indica  2759 73.70% 25.90% 0.33% 0.07% NA
All Japonica  1512 76.00% 24.00% 0.00% 0.00% NA
Aus  269 3.30% 87.70% 6.69% 2.23% NA
Indica I  595 87.40% 12.60% 0.00% 0.00% NA
Indica II  465 43.20% 56.60% 0.22% 0.00% NA
Indica III  913 83.70% 15.80% 0.33% 0.22% NA
Indica Intermediate  786 69.80% 29.50% 0.64% 0.00% NA
Temperate Japonica  767 95.30% 4.70% 0.00% 0.00% NA
Tropical Japonica  504 43.10% 56.90% 0.00% 0.00% NA
Japonica Intermediate  241 83.40% 16.60% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 94.80% 2.08% 0.00% NA
Intermediate  90 60.00% 37.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1018945910 C -> T LOC_Os10g35436.1 downstream_gene_variant ; 3337.0bp to feature; MODIFIER silent_mutation Average:89.928; most accessible tissue: Minghui63 root, score: 95.552 N N N N
vg1018945910 C -> T LOC_Os10g35436-LOC_Os10g35440 intergenic_region ; MODIFIER silent_mutation Average:89.928; most accessible tissue: Minghui63 root, score: 95.552 N N N N
vg1018945910 C -> DEL N N silent_mutation Average:89.928; most accessible tissue: Minghui63 root, score: 95.552 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1018945910 C T 0.13 0.12 0.07 0.06 0.08 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1018945910 NA 3.00E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 6.66E-06 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 1.63E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 2.62E-07 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 5.19E-14 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 1.27E-13 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 1.87E-09 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 1.93E-10 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 9.08E-07 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 1.21E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 5.67E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 5.03E-08 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 1.29E-06 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 1.00E-07 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 8.73E-07 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 3.94E-06 1.02E-14 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 2.27E-07 3.60E-17 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 2.47E-12 mr1800_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 1.26E-09 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 1.88E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 1.45E-06 8.85E-14 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018945910 NA 4.55E-06 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251