| Variant ID: vg1018711746 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 18711746 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGTTTACGGCATACAACCTTCATAAACTCTCCATCATCTTTACACTTTTGCAGCTTTGCCCAAAACCGGAGCCAATATGTTGCCTTGAATATTACCTGTA[T/A]
ATATGAGATAGATGGTGATTTATCAAAAACTATATCATTCCTACTCAACCACAGAGCCCAACAAATGGTAGATGCTCCAACAAGTATGAGTTTACTCATC
GATGAGTAAACTCATACTTGTTGGAGCATCTACCATTTGTTGGGCTCTGTGGTTGAGTAGGAATGATATAGTTTTTGATAAATCACCATCTATCTCATAT[A/T]
TACAGGTAATATTCAAGGCAACATATTGGCTCCGGTTTTGGGCAAAGCTGCAAAAGTGTAAAGATGATGGAGAGTTTATGAAGGTTGTATGCCGTAAACT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.10% | 0.20% | 8.68% | 36.06% | NA |
| All Indica | 2759 | 43.70% | 0.10% | 12.65% | 43.53% | NA |
| All Japonica | 1512 | 77.10% | 0.20% | 1.59% | 21.16% | NA |
| Aus | 269 | 38.70% | 0.00% | 6.32% | 55.02% | NA |
| Indica I | 595 | 24.40% | 0.00% | 6.05% | 69.58% | NA |
| Indica II | 465 | 24.10% | 0.00% | 17.20% | 58.71% | NA |
| Indica III | 913 | 68.00% | 0.20% | 13.14% | 18.62% | NA |
| Indica Intermediate | 786 | 41.60% | 0.30% | 14.38% | 43.77% | NA |
| Temperate Japonica | 767 | 92.70% | 0.00% | 0.91% | 6.39% | NA |
| Tropical Japonica | 504 | 47.80% | 0.20% | 1.59% | 50.40% | NA |
| Japonica Intermediate | 241 | 88.40% | 0.80% | 3.73% | 7.05% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 10.42% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 1.10% | 11.11% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1018711746 | T -> A | LOC_Os10g35080.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:14.62; most accessible tissue: Callus, score: 34.762 | N | N | N | N |
| vg1018711746 | T -> A | LOC_Os10g35070.1 | downstream_gene_variant ; 182.0bp to feature; MODIFIER | silent_mutation | Average:14.62; most accessible tissue: Callus, score: 34.762 | N | N | N | N |
| vg1018711746 | T -> A | LOC_Os10g35070.4 | downstream_gene_variant ; 1138.0bp to feature; MODIFIER | silent_mutation | Average:14.62; most accessible tissue: Callus, score: 34.762 | N | N | N | N |
| vg1018711746 | T -> A | LOC_Os10g35070.2 | downstream_gene_variant ; 182.0bp to feature; MODIFIER | silent_mutation | Average:14.62; most accessible tissue: Callus, score: 34.762 | N | N | N | N |
| vg1018711746 | T -> DEL | N | N | silent_mutation | Average:14.62; most accessible tissue: Callus, score: 34.762 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1018711746 | 5.53E-06 | 1.85E-06 | mr1434 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018711746 | 7.30E-06 | 7.30E-06 | mr1640 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018711746 | NA | 6.45E-06 | mr1685 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018711746 | NA | 5.42E-06 | mr1685 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |