Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017940885:

Variant ID: vg1017940885 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17940885
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCTTGGCCCTATTTGTGAAGTTCTTCGACATGGAGTAGGATTCTTAGTCAGAATCGCACGTTCGATGAAATTACTACGAGATTAGGACGTAACATCTA[A/T]
TTGGAGAGGGCTCTCGATTTTGTCTTAACTAGCGACGCCTAAACACAGAGAAACGTGGAGAAGTCCATCTAATACATGGTACTACATGCATGCATTTTTT

Reverse complement sequence

AAAAAATGCATGCATGTAGTACCATGTATTAGATGGACTTCTCCACGTTTCTCTGTGTTTAGGCGTCGCTAGTTAAGACAAAATCGAGAGCCCTCTCCAA[T/A]
TAGATGTTACGTCCTAATCTCGTAGTAATTTCATCGAACGTGCGATTCTGACTAAGAATCCTACTCCATGTCGAAGAACTTCACAAATAGGGCCAAGAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.60% 28.60% 25.90% 5.92% NA
All Indica  2759 45.70% 3.20% 41.57% 9.50% NA
All Japonica  1512 19.50% 76.70% 2.98% 0.79% NA
Aus  269 98.50% 0.40% 1.12% 0.00% NA
Indica I  595 30.60% 1.80% 60.84% 6.72% NA
Indica II  465 41.30% 11.20% 40.43% 7.10% NA
Indica III  913 57.60% 0.10% 29.24% 13.03% NA
Indica Intermediate  786 45.90% 3.20% 41.98% 8.91% NA
Temperate Japonica  767 1.70% 97.50% 0.65% 0.13% NA
Tropical Japonica  504 41.10% 56.90% 1.59% 0.40% NA
Japonica Intermediate  241 31.10% 51.90% 13.28% 3.73% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 26.70% 34.40% 32.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017940885 A -> T LOC_Os10g33820.1 upstream_gene_variant ; 352.0bp to feature; MODIFIER silent_mutation Average:97.432; most accessible tissue: Minghui63 young leaf, score: 98.847 N N N N
vg1017940885 A -> T LOC_Os10g33830.1 downstream_gene_variant ; 4397.0bp to feature; MODIFIER silent_mutation Average:97.432; most accessible tissue: Minghui63 young leaf, score: 98.847 N N N N
vg1017940885 A -> T LOC_Os10g33820-LOC_Os10g33830 intergenic_region ; MODIFIER silent_mutation Average:97.432; most accessible tissue: Minghui63 young leaf, score: 98.847 N N N N
vg1017940885 A -> DEL N N silent_mutation Average:97.432; most accessible tissue: Minghui63 young leaf, score: 98.847 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1017940885 A T -0.02 -0.02 -0.02 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017940885 NA 1.05E-12 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 4.63E-16 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 7.01E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 9.49E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 1.84E-23 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 1.80E-34 mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 1.72E-28 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 1.53E-11 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 8.64E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 9.24E-06 5.01E-07 mr1222_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 1.28E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 1.82E-26 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 4.95E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 2.29E-28 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 4.84E-09 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 1.04E-12 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 6.03E-37 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 2.09E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 1.10E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 2.83E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 3.93E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 2.27E-10 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 3.51E-21 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 3.57E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 3.53E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 1.37E-14 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 2.36E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 8.38E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 4.62E-62 mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 3.33E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 3.53E-06 NA mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 5.78E-07 mr1751_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 3.59E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 1.66E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 5.34E-06 3.59E-07 mr1788_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 6.50E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 1.74E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 5.18E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 4.82E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017940885 NA 4.94E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251