Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017103748:

Variant ID: vg1017103748 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17103748
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, C: 0.28, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCCAAATCAATCCGGAATTCAATTTCTCTCTTGGGTGGCATGGTAGTGAGGTCTTCGGGGAACACTTCTGGGTACTCGCAGACTATGGGGATATCTTC[T/C]
AATTTCCGTGAACTCTTCTCCCTGGTGGTCACAGGGTTTTCCACCTTAATCTGATTTAAGGAGATTCCTTGCTTCGGTGAGACTGATGACTTGTATACCA

Reverse complement sequence

TGGTATACAAGTCATCAGTCTCACCGAAGCAAGGAATCTCCTTAAATCAGATTAAGGTGGAAAACCCTGTGACCACCAGGGAGAAGAGTTCACGGAAATT[A/G]
GAAGATATCCCCATAGTCTGCGAGTACCCAGAAGTGTTCCCCGAAGACCTCACTACCATGCCACCCAAGAGAGAAATTGAATTCCGGATTGATTTGGCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.20% 19.70% 0.04% 0.00% NA
All Indica  2759 98.80% 1.20% 0.04% 0.00% NA
All Japonica  1512 41.80% 58.10% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.70% 0.13% 0.00% NA
Temperate Japonica  767 4.70% 95.30% 0.00% 0.00% NA
Tropical Japonica  504 92.10% 7.90% 0.00% 0.00% NA
Japonica Intermediate  241 54.80% 44.80% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017103748 T -> C LOC_Os10g32649.1 synonymous_variant ; p.Leu529Leu; LOW synonymous_codon Average:17.213; most accessible tissue: Callus, score: 42.054 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017103748 NA 3.08E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1017103748 NA 1.09E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 1.22E-23 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 4.41E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 3.67E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 1.69E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 2.23E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 9.15E-07 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 4.97E-08 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 1.28E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 5.78E-07 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 2.18E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 3.00E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 4.28E-39 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 5.48E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 5.59E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 5.49E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 7.63E-07 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 5.51E-07 3.68E-09 mr1539 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 3.23E-13 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 5.73E-07 1.12E-11 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 2.38E-17 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 1.19E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 8.74E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 3.25E-06 1.52E-07 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 2.12E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 6.54E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 3.18E-06 NA mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 2.75E-22 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 6.18E-08 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 3.01E-21 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 2.00E-08 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 9.40E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 3.03E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 7.50E-08 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 2.59E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 8.61E-18 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 3.98E-15 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 6.03E-07 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 2.41E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 3.50E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 2.49E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 2.77E-44 mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 2.83E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 1.38E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 5.22E-15 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 2.23E-07 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 2.62E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 2.63E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 3.67E-07 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 6.27E-06 mr1903 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 7.97E-22 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 2.61E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 4.91E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 3.10E-37 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 6.99E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017103748 NA 4.42E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251