| Variant ID: vg1016851749 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 16851749 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 99. )
AAAACTTTTGTGAAATATGTAAAATTATACGCCTACATCAAAATATATTTAACAATGAATCAAATGATAGGAAAAAGATTAATAATTACTTAAATTTTTT[A/G]
AATAAGACGAACGGTCAAACATGTGCTAAAAAGTTAACGGCGTCAAACATTTCGAAACGGAGGGAGTACTTCGAAACATGATTCCGCTAACTAGCAGCTG
CAGCTGCTAGTTAGCGGAATCATGTTTCGAAGTACTCCCTCCGTTTCGAAATGTTTGACGCCGTTAACTTTTTAGCACATGTTTGACCGTTCGTCTTATT[T/C]
AAAAAATTTAAGTAATTATTAATCTTTTTCCTATCATTTGATTCATTGTTAAATATATTTTGATGTAGGCGTATAATTTTACATATTTCACAAAAGTTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.70% | 23.70% | 0.40% | 0.15% | NA |
| All Indica | 2759 | 98.90% | 1.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 27.90% | 70.40% | 1.19% | 0.46% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.20% | 1.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 4.80% | 94.00% | 1.04% | 0.13% | NA |
| Tropical Japonica | 504 | 52.40% | 44.80% | 1.59% | 1.19% | NA |
| Japonica Intermediate | 241 | 50.20% | 49.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1016851749 | A -> G | LOC_Os10g32070.1 | upstream_gene_variant ; 2598.0bp to feature; MODIFIER | silent_mutation | Average:49.365; most accessible tissue: Callus, score: 84.874 | N | N | N | N |
| vg1016851749 | A -> G | LOC_Os10g32090.1 | upstream_gene_variant ; 2372.0bp to feature; MODIFIER | silent_mutation | Average:49.365; most accessible tissue: Callus, score: 84.874 | N | N | N | N |
| vg1016851749 | A -> G | LOC_Os10g32080.1 | downstream_gene_variant ; 163.0bp to feature; MODIFIER | silent_mutation | Average:49.365; most accessible tissue: Callus, score: 84.874 | N | N | N | N |
| vg1016851749 | A -> G | LOC_Os10g32100.1 | downstream_gene_variant ; 4979.0bp to feature; MODIFIER | silent_mutation | Average:49.365; most accessible tissue: Callus, score: 84.874 | N | N | N | N |
| vg1016851749 | A -> G | LOC_Os10g32070-LOC_Os10g32080 | intergenic_region ; MODIFIER | silent_mutation | Average:49.365; most accessible tissue: Callus, score: 84.874 | N | N | N | N |
| vg1016851749 | A -> DEL | N | N | silent_mutation | Average:49.365; most accessible tissue: Callus, score: 84.874 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1016851749 | NA | 4.20E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016851749 | NA | 7.45E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016851749 | 2.15E-06 | NA | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016851749 | NA | 6.32E-07 | mr1084 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016851749 | NA | 5.37E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016851749 | NA | 3.50E-18 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016851749 | NA | 4.30E-09 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016851749 | NA | 4.29E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016851749 | NA | 9.32E-07 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1016851749 | NA | 6.85E-06 | mr1171 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/