RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1016820034:

Variant ID: vg1016820034 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16820034
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTGGTGTTCCCCATCCCGGAGACGTCGCACCGGCAAGTGCACCACGTGACGAGCAAGGCGATCAGGCTGGGATCGGGCGGAGACGGCACGGTAGGGTGG[G/A]
TGGACATCTGGCGCGGCATCCTCCTCTGCGACGTGCTCCACGAGAGCCCCAAGCTCCGCGACGTGCCGCTGCCGCCGCCGGCGAAGGGGAACAGCCACAG

Reverse complement sequence

CTGTGGCTGTTCCCCTTCGCCGGCGGCGGCAGCGGCACGTCGCGGAGCTTGGGGCTCTCGTGGAGCACGTCGCAGAGGAGGATGCCGCGCCAGATGTCCA[C/T]
CCACCCTACCGTGCCGTCTCCGCCCGATCCCAGCCTGATCGCCTTGCTCGTCACGTGGTGCACTTGCCGGTGCGACGTCTCCGGGATGGGGAACACCACG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.10%	5.80%	0.72%	11.36%	NA
All Indica	2759	90.30%	0.10%	1.05%	8.59%	NA
All Japonica	1512	81.20%	17.80%	0.07%	0.93%	NA
Aus	269	19.30%	0.00%	1.49%	79.18%	NA
Indica I	595	85.00%	0.00%	1.18%	13.78%	NA
Indica II	465	95.50%	0.00%	1.51%	3.01%	NA
Indica III	913	91.10%	0.00%	0.33%	8.54%	NA
Indica Intermediate	786	90.20%	0.30%	1.53%	8.02%	NA
Temperate Japonica	767	97.50%	2.30%	0.00%	0.13%	NA
Tropical Japonica	504	57.10%	40.90%	0.00%	1.98%	NA
Japonica Intermediate	241	79.70%	18.70%	0.41%	1.24%	NA
VI/Aromatic	96	35.40%	0.00%	0.00%	64.58%	NA
Intermediate	90	82.20%	5.60%	0.00%	12.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016820034	G -> A	LOC_Os10g32010.1	missense_variant ; p.Val161Met; MODERATE	nonsynonymous_codon ; V161M	Average:51.51; most accessible tissue: Minghui63 flower, score: 82.109	probably damaging	2.371	DELETERIOUS	0.00
vg1016820034	G -> DEL	LOC_Os10g32010.1	N	frameshift_variant	Average:51.51; most accessible tissue: Minghui63 flower, score: 82.109	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016820034	NA	4.01E-10	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034	NA	3.27E-06	mr1157	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034	NA	6.50E-09	mr1179	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034	NA	8.63E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034	NA	3.23E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034	NA	5.45E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034	9.96E-06	4.54E-08	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034	NA	4.53E-08	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034	NA	5.45E-06	mr1328	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016820034	NA	5.86E-06	mr1378	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 19 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg1016820034:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact