Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016787143:

Variant ID: vg1016787143 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16787143
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGATAGATGTATGACTCCAGCACTAAACTTAGGACATTAAATTCACTGGCTTATAAATCATATAAGCCAATAAGCTGACTTAAAAATCTAGGCCAATAA[G/A]
CCTAAGCCTTAAACAAAGAGGGACTAAATATCCTAACCAAGTTTTCACCCATGAGTGGGCCAAACCAATCCTTAAAAAGAAATCTTTAAAGGAAAGCTCT

Reverse complement sequence

AGAGCTTTCCTTTAAAGATTTCTTTTTAAGGATTGGTTTGGCCCACTCATGGGTGAAAACTTGGTTAGGATATTTAGTCCCTCTTTGTTTAAGGCTTAGG[C/T]
TTATTGGCCTAGATTTTTAAGTCAGCTTATTGGCTTATATGATTTATAAGCCAGTGAATTTAATGTCCTAAGTTTAGTGCTGGAGTCATACATCTATCTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	22.80%	15.40%	0.38%	61.40%	NA
All Indica	2759	1.10%	18.60%	0.29%	80.03%	NA
All Japonica	1512	67.50%	13.70%	0.46%	18.32%	NA
Aus	269	0.00%	0.40%	0.00%	99.63%	NA
Indica I	595	0.70%	26.60%	0.50%	72.27%	NA
Indica II	465	2.20%	15.50%	0.43%	81.94%	NA
Indica III	913	0.10%	16.50%	0.00%	83.35%	NA
Indica Intermediate	786	2.00%	16.70%	0.38%	80.92%	NA
Temperate Japonica	767	96.10%	0.70%	0.52%	2.74%	NA
Tropical Japonica	504	27.80%	37.90%	0.60%	33.73%	NA
Japonica Intermediate	241	59.80%	4.60%	0.00%	35.68%	NA
VI/Aromatic	96	2.10%	0.00%	0.00%	97.92%	NA
Intermediate	90	26.70%	8.90%	3.33%	61.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016787143	G -> A	LOC_Os10g31970.1	upstream_gene_variant ; 474.0bp to feature; MODIFIER	silent_mutation	Average:71.606; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N
vg1016787143	G -> A	LOC_Os10g31950-LOC_Os10g31970	intergenic_region ; MODIFIER	silent_mutation	Average:71.606; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N
vg1016787143	G -> DEL	N	N	silent_mutation	Average:71.606; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1016787143	G	A	-0.05	-0.03	-0.02	-0.02	-0.03	-0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016787143	NA	8.35E-07	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016787143	NA	1.99E-06	mr1345	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016787143	NA	1.37E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016787143	NA	2.58E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016787143	9.05E-07	1.92E-07	mr1600	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016787143	NA	1.14E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016787143	NA	1.86E-09	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016787143	NA	1.75E-06	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016787143	NA	1.66E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251