Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016628078:

Variant ID: vg1016628078 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16628078
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTATTAGCCAGCTATAAACATATTTTAATGAGATAAAAGATAAGAGAGAAAAGCAGCGGGCTACAGATCTGTAGCCAGCTGCAGCACGGACTCCAAGAC[G/A]
CAGTGTTTGTATGACAGGTGGGACCATATATTCATAGTATAATAAGCAACTATTGTATGAATTGGCTATTAGATTGGCTATAGATGAACTAGAGTAAGTA

Reverse complement sequence

TACTTACTCTAGTTCATCTATAGCCAATCTAATAGCCAATTCATACAATAGTTGCTTATTATACTATGAATATATGGTCCCACCTGTCATACAAACACTG[C/T]
GTCTTGGAGTCCGTGCTGCAGCTGGCTACAGATCTGTAGCCCGCTGCTTTTCTCTCTTATCTTTTATCTCATTAAAATATGTTTATAGCTGGCTAATAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.70%	4.00%	4.91%	62.42%	NA
All Indica	2759	3.20%	0.10%	5.73%	90.97%	NA
All Japonica	1512	78.60%	12.20%	1.79%	7.41%	NA
Aus	269	1.90%	0.00%	14.50%	83.64%	NA
Indica I	595	3.40%	0.00%	7.90%	88.74%	NA
Indica II	465	5.40%	0.20%	2.80%	91.61%	NA
Indica III	913	1.30%	0.00%	3.72%	94.96%	NA
Indica Intermediate	786	4.10%	0.10%	8.14%	87.66%	NA
Temperate Japonica	767	75.90%	19.20%	3.00%	1.96%	NA
Tropical Japonica	504	93.70%	0.00%	0.20%	6.15%	NA
Japonica Intermediate	241	56.00%	15.40%	1.24%	27.39%	NA
VI/Aromatic	96	32.30%	0.00%	6.25%	61.46%	NA
Intermediate	90	44.40%	4.40%	2.22%	48.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016628078	G -> A	LOC_Os10g31720.1	upstream_gene_variant ; 1505.0bp to feature; MODIFIER	silent_mutation	Average:16.452; most accessible tissue: Zhenshan97 flower, score: 25.98	N	N	N	N
vg1016628078	G -> A	LOC_Os10g31720-LOC_Os10g31730	intergenic_region ; MODIFIER	silent_mutation	Average:16.452; most accessible tissue: Zhenshan97 flower, score: 25.98	N	N	N	N
vg1016628078	G -> DEL	N	N	silent_mutation	Average:16.452; most accessible tissue: Zhenshan97 flower, score: 25.98	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016628078	NA	1.45E-09	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016628078	NA	3.94E-07	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016628078	9.14E-08	9.14E-08	mr1409	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016628078	NA	4.86E-10	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016628078	NA	9.75E-10	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016628078	NA	5.23E-07	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016628078	NA	2.39E-06	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016628078	NA	1.37E-07	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251