Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016459333:

Variant ID: vg1016459333 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 16459333
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

CTTCGATGCAAAGCACTACACACGAGTACACGGTACATGGCTATGTTCTTTCCCGATCTTTCCTAACTCACCTTCTTCGTTTTTTGCGCGCATGCTTCCC[A/G]
AAGTACTAAACGGTGCGTATTTTGAAAAAAAATTCTATAGAAAAGTTATTTTAAAAATTAAATTAATCTATTTTTAAAATTTATTTCAGCTAATATTTAA

Reverse complement sequence

TTAAATATTAGCTGAAATAAATTTTAAAAATAGATTAATTTAATTTTTAAAATAACTTTTCTATAGAATTTTTTTTCAAAATACGCACCGTTTAGTACTT[T/C]
GGGAAGCATGCGCGCAAAAAACGAAGAAGGTGAGTTAGGAAAGATCGGGAAAGAACATAGCCATGTACCGTGTACTCGTGTGTAGTGCTTTGCATCGAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	46.70%	0.08%	0.00%	NA
All Indica	2759	86.40%	13.50%	0.07%	0.00%	NA
All Japonica	1512	4.70%	95.30%	0.00%	0.00%	NA
Aus	269	5.60%	94.40%	0.00%	0.00%	NA
Indica I	595	78.30%	21.50%	0.17%	0.00%	NA
Indica II	465	92.50%	7.30%	0.22%	0.00%	NA
Indica III	913	88.10%	11.90%	0.00%	0.00%	NA
Indica Intermediate	786	87.20%	12.80%	0.00%	0.00%	NA
Temperate Japonica	767	1.40%	98.60%	0.00%	0.00%	NA
Tropical Japonica	504	5.20%	94.80%	0.00%	0.00%	NA
Japonica Intermediate	241	14.10%	85.90%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	43.30%	54.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1016459333	A -> G	LOC_Os10g31370.1	upstream_gene_variant ; 4256.0bp to feature; MODIFIER	silent_mutation	Average:70.478; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg1016459333	A -> G	LOC_Os10g31380.1	upstream_gene_variant ; 2135.0bp to feature; MODIFIER	silent_mutation	Average:70.478; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg1016459333	A -> G	LOC_Os10g31380-LOC_Os10g31390	intergenic_region ; MODIFIER	silent_mutation	Average:70.478; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1016459333	NA	2.66E-10	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016459333	NA	4.51E-08	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016459333	1.53E-06	1.53E-06	mr1527	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016459333	NA	3.14E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016459333	NA	7.81E-13	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016459333	NA	7.49E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016459333	NA	2.39E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016459333	NA	1.96E-08	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016459333	NA	2.94E-06	mr1974_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016459333	NA	1.21E-06	mr1974_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016459333	2.64E-07	2.64E-07	mr1983_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016459333	1.08E-07	1.08E-07	mr1984_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251