Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016401246:

Variant ID: vg1016401246 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16401246
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


ACGAAAAGACTACTTAGAGCAGGTATAATAGCAGGCTATAAGCCAGCTGTAAACATATTTTAAACAGATAAATAAGGAGAGAGAAGGACAGTGAGCTACA[G/A]
ATTTATAGCCAGCTGTAACACGGACTCCAAGACGTAGTGTGTGTATGATAGGTGAGACCAGATATTAATAGTGTAGTATGTAACTATTGTATGAATGAGC

Reverse complement sequence

GCTCATTCATACAATAGTTACATACTACACTATTAATATCTGGTCTCACCTATCATACACACACTACGTCTTGGAGTCCGTGTTACAGCTGGCTATAAAT[C/T]
TGTAGCTCACTGTCCTTCTCTCTCCTTATTTATCTGTTTAAAATATGTTTACAGCTGGCTTATAGCCTGCTATTATACCTGCTCTAAGTAGTCTTTTCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.80% 14.30% 2.24% 46.68% NA
All Indica  2759 27.20% 12.30% 3.04% 57.45% NA
All Japonica  1512 62.20% 0.70% 1.32% 35.71% NA
Aus  269 4.80% 92.90% 0.37% 1.86% NA
Indica I  595 15.80% 22.00% 3.19% 58.99% NA
Indica II  465 24.30% 4.10% 3.66% 67.96% NA
Indica III  913 33.40% 11.80% 2.52% 52.25% NA
Indica Intermediate  786 30.30% 10.40% 3.18% 56.11% NA
Temperate Japonica  767 96.20% 0.00% 0.26% 3.52% NA
Tropical Japonica  504 9.70% 1.20% 3.17% 85.91% NA
Japonica Intermediate  241 63.90% 2.10% 0.83% 33.20% NA
VI/Aromatic  96 5.20% 64.60% 0.00% 30.21% NA
Intermediate  90 31.10% 15.60% 1.11% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016401246 G -> A LOC_Os10g31250-LOC_Os10g31280 intergenic_region ; MODIFIER silent_mutation Average:52.946; most accessible tissue: Callus, score: 95.536 N N N N
vg1016401246 G -> DEL N N silent_mutation Average:52.946; most accessible tissue: Callus, score: 95.536 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1016401246 G A -0.03 0.0 -0.02 -0.03 -0.02 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016401246 NA 8.26E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1016401246 9.23E-06 9.23E-06 mr1527 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016401246 NA 4.98E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016401246 NA 2.84E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016401246 NA 1.42E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016401246 NA 4.30E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016401246 NA 6.80E-09 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016401246 6.18E-06 6.52E-07 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016401246 5.63E-07 5.63E-07 mr1983_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016401246 5.73E-07 5.73E-07 mr1984_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251