Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016363154:

Variant ID: vg1016363154 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16363154
Reference Allele: TAlternative Allele: G,C
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, G: 0.04, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


AACAATAATACGCCTCCACGTTTCTACTATCGCTAACTGATGTGATAGAATAAACAAATATGAATTCTTCCATCAAATAAGATGGACGATTCAACCATAG[T/G,C]
GAGGCTTTCAATATTAATGTTGGAGGCTTGGAGCACCAAAGTACAGGCATATTATTGTCCACTGGCGACAAGGAAGAGATCTGAGAAAGTTGTACAAACG

Reverse complement sequence

CGTTTGTACAACTTTCTCAGATCTCTTCCTTGTCGCCAGTGGACAATAATATGCCTGTACTTTGGTGCTCCAAGCCTCCAACATTAATATTGAAAGCCTC[A/C,G]
CTATGGTTGAATCGTCCATCTTATTTGATGGAAGAATTCATATTTGTTTATTCTATCACATCAGTTAGCGATAGTAGAAACGTGGAGGCGTATTATTGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.60% 5.90% 1.06% 40.29% C: 0.06%
All Indica  2759 33.90% 0.40% 1.38% 64.37% NA
All Japonica  1512 80.00% 15.00% 0.73% 4.10% C: 0.20%
Aus  269 83.30% 14.90% 0.00% 1.86% NA
Indica I  595 33.10% 0.20% 1.51% 65.21% NA
Indica II  465 25.40% 0.20% 0.65% 73.76% NA
Indica III  913 37.70% 0.10% 1.42% 60.79% NA
Indica Intermediate  786 35.10% 0.90% 1.65% 62.34% NA
Temperate Japonica  767 85.80% 11.50% 1.30% 1.04% C: 0.39%
Tropical Japonica  504 89.10% 6.30% 0.20% 4.37% NA
Japonica Intermediate  241 42.30% 44.40% 0.00% 13.28% NA
VI/Aromatic  96 69.80% 0.00% 1.04% 29.17% NA
Intermediate  90 58.90% 4.40% 0.00% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016363154 T -> C LOC_Os10g31200.1 downstream_gene_variant ; 3566.0bp to feature; MODIFIER silent_mutation Average:37.509; most accessible tissue: Minghui63 root, score: 80.163 N N N N
vg1016363154 T -> C LOC_Os10g31200-LOC_Os10g31220 intergenic_region ; MODIFIER silent_mutation Average:37.509; most accessible tissue: Minghui63 root, score: 80.163 N N N N
vg1016363154 T -> G LOC_Os10g31200.1 downstream_gene_variant ; 3566.0bp to feature; MODIFIER silent_mutation Average:37.509; most accessible tissue: Minghui63 root, score: 80.163 N N N N
vg1016363154 T -> G LOC_Os10g31200-LOC_Os10g31220 intergenic_region ; MODIFIER silent_mutation Average:37.509; most accessible tissue: Minghui63 root, score: 80.163 N N N N
vg1016363154 T -> DEL N N silent_mutation Average:37.509; most accessible tissue: Minghui63 root, score: 80.163 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1016363154 T C 0.04 -0.01 0.01 -0.03 -0.01 0.01
vg1016363154 T G 0.02 0.0 -0.01 0.02 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016363154 3.47E-06 NA mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 1.02E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 6.23E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 7.43E-07 NA mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 2.63E-07 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 4.23E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 1.95E-07 NA mr1242 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 8.54E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 2.13E-06 NA mr1247 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 1.32E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 8.55E-09 NA mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 1.27E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 4.72E-06 NA mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 5.70E-06 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 3.75E-06 NA mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 3.87E-08 NA mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 2.77E-08 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 6.36E-06 NA mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 5.54E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 2.03E-06 NA mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 7.86E-07 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 3.22E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 3.30E-07 NA mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 1.02E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 4.18E-06 NA mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 1.92E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 3.07E-07 NA mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 3.44E-07 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 2.24E-07 NA mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 1.33E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 2.49E-06 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 2.84E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 3.50E-06 NA mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 1.63E-06 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 2.63E-08 NA mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 2.32E-08 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 1.50E-06 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 9.03E-06 NA mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 7.28E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 9.89E-06 NA mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016363154 NA 6.46E-06 mr1961_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251