Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1016331604:

Variant ID: vg1016331604 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 16331604
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAGTCAAATAACTAGCAAAGTTAATGTGGGGTATAAAATTTTCCTTCAATAAATTATGGCTGAAAATATTTTATAGATTCAATAATATCTCATGCCGGC[G/A]
TAGGTAAGGCCCATCAGGCTGACCTCCTCCTCAATCCAATAGTGGTGAGGTGCCCCTTCATCGTCGTCTACCCCATCGCCAACGGCTTCCTGGCGCCACA

Reverse complement sequence

TGTGGCGCCAGGAAGCCGTTGGCGATGGGGTAGACGACGATGAAGGGGCACCTCACCACTATTGGATTGAGGAGGAGGTCAGCCTGATGGGCCTTACCTA[C/T]
GCCGGCATGAGATATTATTGAATCTATAAAATATTTTCAGCCATAATTTATTGAAGGAAAATTTTATACCCCACATTAACTTTGCTAGTTATTTGACTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 5.90% 0.00% 0.66% NA
All Indica  2759 99.60% 0.30% 0.00% 0.04% NA
All Japonica  1512 84.90% 15.00% 0.00% 0.13% NA
Aus  269 85.10% 14.90% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.00% 0.22% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 88.50% 11.50% 0.00% 0.00% NA
Tropical Japonica  504 93.70% 6.30% 0.00% 0.00% NA
Japonica Intermediate  241 54.80% 44.40% 0.00% 0.83% NA
VI/Aromatic  96 76.00% 0.00% 0.00% 23.96% NA
Intermediate  90 90.00% 4.40% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1016331604 G -> A LOC_Os10g31170.1 downstream_gene_variant ; 4394.0bp to feature; MODIFIER silent_mutation Average:68.074; most accessible tissue: Zhenshan97 panicle, score: 90.467 N N N N
vg1016331604 G -> A LOC_Os10g31180.1 downstream_gene_variant ; 4638.0bp to feature; MODIFIER silent_mutation Average:68.074; most accessible tissue: Zhenshan97 panicle, score: 90.467 N N N N
vg1016331604 G -> A LOC_Os10g31170-LOC_Os10g31180 intergenic_region ; MODIFIER silent_mutation Average:68.074; most accessible tissue: Zhenshan97 panicle, score: 90.467 N N N N
vg1016331604 G -> DEL N N silent_mutation Average:68.074; most accessible tissue: Zhenshan97 panicle, score: 90.467 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1016331604 G A -0.04 -0.02 -0.02 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1016331604 3.18E-06 NA mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 4.79E-06 NA mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 1.57E-06 NA mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 NA 4.43E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 3.96E-07 NA mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 7.66E-09 NA mr1496 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 NA 1.69E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 2.24E-06 NA mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 1.80E-08 NA mr1113_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 NA 1.90E-07 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 6.42E-06 NA mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 2.43E-06 NA mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 1.60E-07 NA mr1119_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 NA 1.60E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 4.90E-06 NA mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 4.98E-07 NA mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 3.94E-08 NA mr1240_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 NA 7.81E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 1.39E-06 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 4.45E-06 NA mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 5.01E-09 NA mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1016331604 NA 1.39E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251