Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015983381:

Variant ID: vg1015983381 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 15983381
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TGGGATTTTATTTTTCGGTCTGTTTAAAATTGCAGTACTTTCGTGTTGATGATTCCTTCTTTCGTCAATAAATAGGATTCAGAGCTACTACATTGAGTTC[A/G]
GCAAAGGTATATGTGTTGCAAATTACACTATGTCTCTAAACATTTTCTAAGTTACATGGTGAAACTATTATTAAGATATCTATATCATATCATACTGTTA

Reverse complement sequence

TAACAGTATGATATGATATAGATATCTTAATAATAGTTTCACCATGTAACTTAGAAAATGTTTAGAGACATAGTGTAATTTGCAACACATATACCTTTGC[T/C]
GAACTCAATGTAGTAGCTCTGAATCCTATTTATTGACGAAAGAAGGAATCATCAACACGAAAGTACTGCAATTTTAAACAGACCGAAAAATAAAATCCCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.30%	3.80%	4.87%	42.02%	NA
All Indica	2759	19.00%	5.00%	6.67%	69.41%	NA
All Japonica	1512	99.50%	0.00%	0.20%	0.26%	NA
Aus	269	68.00%	8.20%	10.04%	13.75%	NA
Indica I	595	12.10%	0.20%	8.40%	79.33%	NA
Indica II	465	21.90%	11.60%	5.81%	60.65%	NA
Indica III	913	12.40%	3.10%	6.24%	78.31%	NA
Indica Intermediate	786	30.00%	6.90%	6.36%	56.74%	NA
Temperate Japonica	767	99.20%	0.00%	0.39%	0.39%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	53.10%	20.80%	13.54%	12.50%	NA
Intermediate	90	74.40%	2.20%	3.33%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015983381	A -> G	LOC_Os10g30680.1	upstream_gene_variant ; 2856.0bp to feature; MODIFIER	silent_mutation	Average:52.133; most accessible tissue: Minghui63 young leaf, score: 80.562	N	N	N	N
vg1015983381	A -> G	LOC_Os10g30690.1	upstream_gene_variant ; 415.0bp to feature; MODIFIER	silent_mutation	Average:52.133; most accessible tissue: Minghui63 young leaf, score: 80.562	N	N	N	N
vg1015983381	A -> G	LOC_Os10g30680-LOC_Os10g30690	intergenic_region ; MODIFIER	silent_mutation	Average:52.133; most accessible tissue: Minghui63 young leaf, score: 80.562	N	N	N	N
vg1015983381	A -> DEL	N	N	silent_mutation	Average:52.133; most accessible tissue: Minghui63 young leaf, score: 80.562	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015983381	2.67E-14	3.90E-15	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015983381	5.06E-09	5.55E-10	mr1309	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015983381	7.03E-06	5.32E-07	mr1484	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015983381	5.00E-06	3.79E-07	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015983381	5.28E-07	4.23E-09	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015983381	2.90E-07	3.05E-09	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015983381	4.59E-08	2.18E-10	mr1841_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015983381	NA	9.19E-08	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015983381	6.71E-06	6.71E-06	mr1945_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251