Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015982479:

Variant ID: vg1015982479 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 15982479
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

TTACTTTTGACAAATAGAGGTTCGTTCGGTCTATGATCACATATTTATATGTATAATTTTTGTATGACCAGTAACATTGGCCAAGCAGAGTGTATTTTGG[A/G]
TGAACTGAATGTGTTATTGTACCCTCAAGTACTTTCGTATTTTTCTATACGAAATATTTTTTTTATTTTACTGAAAGCTGGGCTTGAATATATGTTTTTG

Reverse complement sequence

CAAAAACATATATTCAAGCCCAGCTTTCAGTAAAATAAAAAAAATATTTCGTATAGAAAAATACGAAAGTACTTGAGGGTACAATAACACATTCAGTTCA[T/C]
CCAAAATACACTCTGCTTGGCCAATGTTACTGGTCATACAAAAATTATACATATAAATATGTGATCATAGACCGAACGAACCTCTATTTGTCAAAAGTAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.50%	0.40%	2.64%	45.37%	NA
All Indica	2759	22.70%	0.60%	3.77%	72.96%	NA
All Japonica	1512	99.10%	0.00%	0.00%	0.93%	NA
Aus	269	69.90%	1.10%	4.46%	24.54%	NA
Indica I	595	13.30%	0.20%	4.37%	82.18%	NA
Indica II	465	26.00%	1.30%	4.95%	67.74%	NA
Indica III	913	18.60%	0.40%	3.18%	77.77%	NA
Indica Intermediate	786	32.40%	0.80%	3.31%	63.49%	NA
Temperate Japonica	767	98.30%	0.00%	0.00%	1.69%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	59.40%	1.00%	8.33%	31.25%	NA
Intermediate	90	75.60%	0.00%	1.11%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015982479	A -> G	LOC_Os10g30680.1	upstream_gene_variant ; 1954.0bp to feature; MODIFIER	silent_mutation	Average:30.412; most accessible tissue: Callus, score: 70.781	N	N	N	N
vg1015982479	A -> G	LOC_Os10g30690.1	upstream_gene_variant ; 1317.0bp to feature; MODIFIER	silent_mutation	Average:30.412; most accessible tissue: Callus, score: 70.781	N	N	N	N
vg1015982479	A -> G	LOC_Os10g30680-LOC_Os10g30690	intergenic_region ; MODIFIER	silent_mutation	Average:30.412; most accessible tissue: Callus, score: 70.781	N	N	N	N
vg1015982479	A -> DEL	N	N	silent_mutation	Average:30.412; most accessible tissue: Callus, score: 70.781	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015982479	1.62E-14	2.24E-15	mr1238	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479	2.14E-07	2.89E-08	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479	6.84E-06	3.78E-07	mr1484	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479	NA	1.95E-06	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479	7.28E-06	7.28E-06	mr1945	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479	4.73E-07	2.10E-09	mr1238_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479	2.78E-07	1.44E-09	mr1484_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479	7.12E-08	2.96E-10	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479	NA	1.19E-07	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015982479	1.42E-06	1.42E-06	mr1945_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251