| Variant ID: vg1015779989 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 15779989 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 97. )
ATCTATACATAGTGAAACATTGTGAGTATACTAGGTGAAATATTTTTCGGTGGAACAAAAAATAAACCAAATTCCCTTAATACCCTTAATAGGGGGTTTC[C/T]
AAAATATGTGGGTTTTTTATTGCAATGGAATGTTTCATTCACTACAACATTAGATCTATACATAGTGAAATATTGTGAGTACACTAGGTGAAACATTTTT
AAAAATGTTTCACCTAGTGTACTCACAATATTTCACTATGTATAGATCTAATGTTGTAGTGAATGAAACATTCCATTGCAATAAAAAACCCACATATTTT[G/A]
GAAACCCCCTATTAAGGGTATTAAGGGAATTTGGTTTATTTTTTGTTCCACCGAAAAATATTTCACCTAGTATACTCACAATGTTTCACTATGTATAGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 3.40% | 5.80% | 1.04% | NA |
| All Indica | 2759 | 83.30% | 5.80% | 9.21% | 1.74% | NA |
| All Japonica | 1512 | 99.80% | 0.00% | 0.13% | 0.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 76.80% | 4.00% | 16.64% | 2.52% | NA |
| Indica II | 465 | 86.50% | 6.90% | 4.73% | 1.94% | NA |
| Indica III | 913 | 86.40% | 7.10% | 5.26% | 1.20% | NA |
| Indica Intermediate | 786 | 82.60% | 5.00% | 10.81% | 1.65% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 0.00% | 16.67% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 1.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1015779989 | C -> T | LOC_Os10g30370.1 | upstream_gene_variant ; 2091.0bp to feature; MODIFIER | silent_mutation | Average:41.104; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1015779989 | C -> T | LOC_Os10g30370.2 | upstream_gene_variant ; 481.0bp to feature; MODIFIER | silent_mutation | Average:41.104; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1015779989 | C -> T | LOC_Os10g30360.1 | downstream_gene_variant ; 4524.0bp to feature; MODIFIER | silent_mutation | Average:41.104; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1015779989 | C -> T | LOC_Os10g30360-LOC_Os10g30370 | intergenic_region ; MODIFIER | silent_mutation | Average:41.104; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1015779989 | C -> DEL | N | N | silent_mutation | Average:41.104; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1015779989 | NA | 7.71E-06 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015779989 | NA | 1.19E-06 | mr1376_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015779989 | NA | 6.32E-06 | mr1386_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015779989 | NA | 1.31E-06 | mr1431_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015779989 | NA | 8.38E-07 | mr1594_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015779989 | NA | 2.10E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015779989 | NA | 1.53E-07 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015779989 | 6.12E-06 | 2.80E-08 | mr1696_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015779989 | 3.97E-06 | 6.39E-08 | mr1696_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015779989 | NA | 7.30E-06 | mr1759_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1015779989 | NA | 2.31E-06 | mr1838_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |