Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1015182126:

Variant ID: vg1015182126 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 15182126
Reference Allele: C	Alternative Allele: T,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.56, T: 0.46, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTGAATTTCATGATAATAAAGAGTAAGCGGCGAACGGGTCATAGAGGAGTATATTGGCAGCGTTTGACGAGATTTCTAAAAATTATAAAAAATGAAA[C/T,A]
CCAACGAGACAATAAACTCAAAAAACTATAAGGTCCAATTTTTAAAGGTTCAGGCTTCTAAAACGTAAAAAATAAATAAACCCTAATGATAATCATGTTT

Reverse complement sequence

AAACATGATTATCATTAGGGTTTATTTATTTTTTACGTTTTAGAAGCCTGAACCTTTAAAAATTGGACCTTATAGTTTTTTGAGTTTATTGTCTCGTTGG[G/A,T]
TTTCATTTTTTATAATTTTTAGAAATCTCGTCAAACGCTGCCAATATACTCCTCTATGACCCGTTCGCCGCTTACTCTTTATTATCATGAAATTCAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.00%	31.90%	5.27%	4.78%	A: 0.08%
All Indica	2759	86.30%	4.00%	7.25%	2.36%	A: 0.14%
All Japonica	1512	2.60%	88.70%	2.38%	6.35%	NA
Aus	269	95.90%	2.20%	1.86%	0.00%	NA
Indica I	595	80.70%	4.70%	13.61%	1.01%	NA
Indica II	465	87.70%	4.10%	4.30%	3.87%	NA
Indica III	913	88.70%	2.30%	5.70%	2.85%	A: 0.44%
Indica Intermediate	786	86.90%	5.20%	5.98%	1.91%	NA
Temperate Japonica	767	0.50%	96.90%	0.39%	2.22%	NA
Tropical Japonica	504	4.00%	77.20%	5.16%	13.69%	NA
Japonica Intermediate	241	6.20%	86.70%	2.90%	4.15%	NA
VI/Aromatic	96	20.80%	15.60%	1.04%	62.50%	NA
Intermediate	90	47.80%	38.90%	7.78%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1015182126	C -> T	LOC_Os10g29150.1	downstream_gene_variant ; 526.0bp to feature; MODIFIER	silent_mutation	Average:21.291; most accessible tissue: Minghui63 flag leaf, score: 29.435	N	N	N	N
vg1015182126	C -> T	LOC_Os10g29159.1	downstream_gene_variant ; 4627.0bp to feature; MODIFIER	silent_mutation	Average:21.291; most accessible tissue: Minghui63 flag leaf, score: 29.435	N	N	N	N
vg1015182126	C -> T	LOC_Os10g29130-LOC_Os10g29150	intergenic_region ; MODIFIER	silent_mutation	Average:21.291; most accessible tissue: Minghui63 flag leaf, score: 29.435	N	N	N	N
vg1015182126	C -> A	LOC_Os10g29150.1	downstream_gene_variant ; 526.0bp to feature; MODIFIER	silent_mutation	Average:21.291; most accessible tissue: Minghui63 flag leaf, score: 29.435	N	N	N	N
vg1015182126	C -> A	LOC_Os10g29159.1	downstream_gene_variant ; 4627.0bp to feature; MODIFIER	silent_mutation	Average:21.291; most accessible tissue: Minghui63 flag leaf, score: 29.435	N	N	N	N
vg1015182126	C -> A	LOC_Os10g29130-LOC_Os10g29150	intergenic_region ; MODIFIER	silent_mutation	Average:21.291; most accessible tissue: Minghui63 flag leaf, score: 29.435	N	N	N	N
vg1015182126	C -> DEL	N	N	silent_mutation	Average:21.291; most accessible tissue: Minghui63 flag leaf, score: 29.435	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1015182126	NA	1.68E-21	mr1122	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182126	NA	6.96E-25	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182126	NA	4.73E-26	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182126	NA	2.37E-09	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182126	NA	2.27E-08	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182126	NA	4.11E-23	mr1168_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182126	NA	6.12E-20	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1015182126	NA	8.75E-16	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251