Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014950297:

Variant ID: vg1014950297 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 14950297
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.21, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

GCCAAAACTTGACACCCCTGAATATAAACACCCCCTTAGCAAGAAAAATATGTTCATGGAAAGTTTCACAATGACCATATTGACCACAAGAAAAAAAGGG[A/G]
TTACACTCAGCTTGAGTTTGTTAGGAATCAGGAGTTCATAAATAAAGATGAAAGAGCACAAAACACTGGTCTATCTTGAAATTCTTGTGAGAAATAGACA

Reverse complement sequence

TGTCTATTTCTCACAAGAATTTCAAGATAGACCAGTGTTTTGTGCTCTTTCATCTTTATTTATGAACTCCTGATTCCTAACAAACTCAAGCTGAGTGTAA[T/C]
CCCTTTTTTTCTTGTGGTCAATATGGTCATTGTGAAACTTTCCATGAACATATTTTTCTTGCTAAGGGGGTGTTTATATTCAGGGGTGTCAAGTTTTGGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.30%	28.70%	0.04%	0.00%	NA
All Indica	2759	57.90%	42.00%	0.07%	0.00%	NA
All Japonica	1512	97.90%	2.10%	0.00%	0.00%	NA
Aus	269	89.20%	10.80%	0.00%	0.00%	NA
Indica I	595	83.00%	16.80%	0.17%	0.00%	NA
Indica II	465	40.20%	59.80%	0.00%	0.00%	NA
Indica III	913	53.60%	46.40%	0.00%	0.00%	NA
Indica Intermediate	786	54.30%	45.50%	0.13%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	97.20%	2.80%	0.00%	0.00%	NA
Japonica Intermediate	241	93.40%	6.60%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	51.10%	48.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1014950297	A -> G	LOC_Os10g28660.1	downstream_gene_variant ; 1297.0bp to feature; MODIFIER	silent_mutation	Average:50.047; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg1014950297	A -> G	LOC_Os10g28665.2	downstream_gene_variant ; 4726.0bp to feature; MODIFIER	silent_mutation	Average:50.047; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg1014950297	A -> G	LOC_Os10g28660-LOC_Os10g28665	intergenic_region ; MODIFIER	silent_mutation	Average:50.047; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1014950297	NA	7.57E-06	mr1036_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014950297	NA	1.03E-10	mr1169_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014950297	NA	2.50E-06	mr1169_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014950297	NA	1.99E-10	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014950297	NA	2.68E-07	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014950297	NA	4.73E-10	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014950297	NA	1.04E-08	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251