Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014784092:

Variant ID: vg1014784092 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 14784092
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

GGGACGTTTCGCATCTAGGCCGCCGCGCCGTCGTGCATCGAGCCCGCCACCGCCGTCATGCATCCAGTCGCCGCCGTCGCGCATCCCTCCGCCGCCGTTG[C/T]
GCATCGACTGCCGCCGCCGTCGCGCATCTGGCTGCCCCTGCCTCTCGCGGTCTCGCTGCCCTCCCGACGATTTTTTCCCTCTCGTGAAACAGGAAATGAC

Reverse complement sequence

GTCATTTCCTGTTTCACGAGAGGGAAAAAATCGTCGGGAGGGCAGCGAGACCGCGAGAGGCAGGGGCAGCCAGATGCGCGACGGCGGCGGCAGTCGATGC[G/A]
CAACGGCGGCGGAGGGATGCGCGACGGCGGCGACTGGATGCATGACGGCGGTGGCGGGCTCGATGCACGACGGCGCGGCGGCCTAGATGCGAAACGTCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.80%	7.50%	5.78%	1.88%	NA
All Indica	2759	76.20%	12.40%	8.12%	3.23%	NA
All Japonica	1512	99.00%	0.10%	0.86%	0.00%	NA
Aus	269	89.60%	0.40%	10.04%	0.00%	NA
Indica I	595	93.60%	1.30%	4.87%	0.17%	NA
Indica II	465	46.70%	31.20%	15.27%	6.88%	NA
Indica III	913	80.20%	9.90%	6.79%	3.18%	NA
Indica Intermediate	786	76.00%	12.70%	7.89%	3.44%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	99.00%	0.00%	0.99%	0.00%	NA
Japonica Intermediate	241	96.70%	0.40%	2.90%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	82.20%	8.90%	8.89%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1014784092	C -> T	LOC_Os10g28420.1	upstream_gene_variant ; 1025.0bp to feature; MODIFIER	silent_mutation	Average:67.601; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N
vg1014784092	C -> T	LOC_Os10g28410-LOC_Os10g28420	intergenic_region ; MODIFIER	silent_mutation	Average:67.601; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N
vg1014784092	C -> DEL	N	N	silent_mutation	Average:67.601; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1014784092	NA	3.86E-10	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014784092	NA	1.54E-07	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014784092	NA	2.03E-15	mr1174_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014784092	NA	1.00E-13	mr1174_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014784092	NA	1.34E-12	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014784092	NA	2.60E-12	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014784092	NA	4.07E-06	mr1406_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251