Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014156474:

Variant ID: vg1014156474 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 14156474
Reference Allele: AT	Alternative Allele: A,TT
Primary Allele: AT	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAACAGACATAATGGGATGGTGAGTGAATAACAATGACTTTGCTTCATATTTTTCAAGTCAATGCACTAGTATTATTTGGAATTAGTATAAACTTGTTT[AT/A,TT]
TTTTTTTGTTGAATATAGGTGCAACCAGGAGTTGCCAGAGAATTGCAAGTTAATCAAAATATGCATGTTACGAAGGTGAGCTGAATAACATCGATTTTAC

Reverse complement sequence

GTAAAATCGATGTTATTCAGCTCACCTTCGTAACATGCATATTTTGATTAACTTGCAATTCTCTGGCAACTCCTGGTTGCACCTATATTCAACAAAAAAA[AT/T,AA]
AAACAAGTTTATACTAATTCCAAATAATACTAGTGCATTGACTTGAAAAATATGAAGCAAAGTCATTGTTATTCACTCACCATCCCATTATGTCTGTTAT

Allele Frequencies:

Populations	Population Size	Frequency of AT(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.30%	5.20%	31.25%	27.55%	TT: 1.67%
All Indica	2759	2.50%	8.80%	51.03%	37.59%	TT: 0.04%
All Japonica	1512	92.70%	0.00%	1.65%	0.60%	TT: 5.09%
Aus	269	1.10%	0.00%	11.15%	87.36%	TT: 0.37%
Indica I	595	1.70%	6.20%	43.36%	48.74%	NA
Indica II	465	3.40%	8.60%	59.57%	28.39%	NA
Indica III	913	1.00%	10.70%	55.31%	32.97%	NA
Indica Intermediate	786	4.50%	8.70%	46.82%	39.95%	TT: 0.13%
Temperate Japonica	767	89.60%	0.00%	2.87%	0.13%	TT: 7.43%
Tropical Japonica	504	96.60%	0.00%	0.20%	0.99%	TT: 2.18%
Japonica Intermediate	241	94.20%	0.00%	0.83%	1.24%	TT: 3.73%
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	57.80%	5.60%	15.56%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1014156474	AT -> TT	LOC_Os10g26920.1	upstream_gene_variant ; 2317.0bp to feature; MODIFIER	silent_mutation	Average:12.622; most accessible tissue: Callus, score: 33.297	N	N	N	N
vg1014156474	AT -> TT	LOC_Os10g26890-LOC_Os10g26920	intergenic_region ; MODIFIER	silent_mutation	Average:12.622; most accessible tissue: Callus, score: 33.297	N	N	N	N
vg1014156474	AT -> A	LOC_Os10g26920.1	upstream_gene_variant ; 2316.0bp to feature; MODIFIER	silent_mutation	Average:12.622; most accessible tissue: Callus, score: 33.297	N	N	N	N
vg1014156474	AT -> A	LOC_Os10g26890-LOC_Os10g26920	intergenic_region ; MODIFIER	silent_mutation	Average:12.622; most accessible tissue: Callus, score: 33.297	N	N	N	N
vg1014156474	AT -> DEL	N	N	silent_mutation	Average:12.622; most accessible tissue: Callus, score: 33.297	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1014156474	2.01E-06	2.01E-06	mr1234_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251