Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014073653:

Variant ID: vg1014073653 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 14073653
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCGCCTACCACTGAAAGCACAACGCCGTTAAATCCTGGAAAATTCGCTCCCATGGGGAGTCGAACCCAGGACATCAGGTGCTACTGAGGCTCTTGTAA[C/G]
CACTAGGCTACAGGCCCTTTCGCTGCAAGATATGGTTTGTATCTAAGTGATATATTTGTTTGGCCCTTAACAAATAACAAGTTATTGGCAGATACCAGAT

Reverse complement sequence

ATCTGGTATCTGCCAATAACTTGTTATTTGTTAAGGGCCAAACAAATATATCACTTAGATACAAACCATATCTTGCAGCGAAAGGGCCTGTAGCCTAGTG[G/C]
TTACAAGAGCCTCAGTAGCACCTGATGTCCTGGGTTCGACTCCCCATGGGAGCGAATTTTCCAGGATTTAACGGCGTTGTGCTTTCAGTGGTAGGCGACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.30% 1.50% 3.58% 60.56% NA
All Indica  2759 2.10% 0.00% 4.53% 93.33% NA
All Japonica  1512 93.60% 4.60% 1.19% 0.60% NA
Aus  269 1.90% 0.40% 8.55% 89.22% NA
Indica I  595 1.30% 0.00% 0.50% 98.15% NA
Indica II  465 3.40% 0.00% 3.01% 93.55% NA
Indica III  913 1.20% 0.00% 7.12% 91.68% NA
Indica Intermediate  786 2.90% 0.10% 5.47% 91.48% NA
Temperate Japonica  767 92.30% 5.70% 1.83% 0.13% NA
Tropical Japonica  504 98.40% 0.20% 0.40% 0.99% NA
Japonica Intermediate  241 87.60% 10.40% 0.83% 1.24% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 56.70% 0.00% 3.33% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1014073653 C -> G LOC_Os10g26820.1 downstream_gene_variant ; 1209.0bp to feature; MODIFIER silent_mutation Average:79.023; most accessible tissue: Minghui63 root, score: 88.244 N N N N
vg1014073653 C -> G LOC_Os10g26810-LOC_Os10g26820 intergenic_region ; MODIFIER silent_mutation Average:79.023; most accessible tissue: Minghui63 root, score: 88.244 N N N N
vg1014073653 C -> DEL N N silent_mutation Average:79.023; most accessible tissue: Minghui63 root, score: 88.244 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1014073653 C G 0.02 0.0 0.01 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1014073653 NA 2.14E-06 mr1174_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014073653 NA 2.53E-06 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014073653 7.14E-06 7.14E-06 mr1302_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014073653 1.65E-06 1.65E-06 mr1604_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014073653 NA 7.00E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014073653 4.08E-06 3.42E-07 mr1813_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014073653 2.32E-06 2.32E-06 mr1814_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014073653 4.64E-06 4.64E-06 mr1854_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014073653 3.40E-06 4.93E-07 mr1894_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251