Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013767614:

Variant ID: vg1013767614 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13767614
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAATAAGTAGACCGGTACGTGAATTTGACAATCATGTGCATTTTAGGCCAAAACACTAATACATATATTTGATTAATCTTGGTATTATAAGCTTTGCT[A/C]
GATCGTTGGCTCATGGATTCATTTTTGTGTTTCACCATGTTTATAACCCGGGATAATGAATATGTTGATTAGTCATGCACTTACTTTTGATAATCATATA

Reverse complement sequence

TATATGATTATCAAAAGTAAGTGCATGACTAATCAACATATTCATTATCCCGGGTTATAAACATGGTGAAACACAAAAATGAATCCATGAGCCAACGATC[T/G]
AGCAAAGCTTATAATACCAAGATTAATCAAATATATGTATTAGTGTTTTGGCCTAAAATGCACATGATTGTCAAATTCACGTACCGGTCTACTTATTTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.10%	9.90%	0.99%	0.00%	NA
All Indica	2759	81.40%	17.00%	1.67%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	71.90%	23.20%	4.87%	0.00%	NA
Indica II	465	89.90%	9.90%	0.22%	0.00%	NA
Indica III	913	86.00%	14.00%	0.00%	0.00%	NA
Indica Intermediate	786	78.10%	19.80%	2.04%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013767614	A -> C	LOC_Os10g26440.1	upstream_gene_variant ; 1943.0bp to feature; MODIFIER	silent_mutation	Average:55.192; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1013767614	A -> C	LOC_Os10g26430.1	downstream_gene_variant ; 4215.0bp to feature; MODIFIER	silent_mutation	Average:55.192; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1013767614	A -> C	LOC_Os10g26450.1	downstream_gene_variant ; 950.0bp to feature; MODIFIER	silent_mutation	Average:55.192; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1013767614	A -> C	LOC_Os10g26450-LOC_Os10g26460	intergenic_region ; MODIFIER	silent_mutation	Average:55.192; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013767614	1.74E-07	NA	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013767614	6.25E-08	3.98E-11	mr1533	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013767614	2.10E-06	NA	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013767614	9.46E-07	2.54E-09	mr1980	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013767614	9.92E-08	NA	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013767614	3.51E-08	1.22E-13	mr1533_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013767614	NA	8.19E-06	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251