Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013729406:

Variant ID: vg1013729406 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13729406
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, A: 0.16, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTAACGGGCATATTTGATCTTTAGTCCCGGTTGGTAACAACAATCGGGACTAAAGATCATCTTTTGTCCCGGTTCAAATGCTGTCAGGTCTTGGCAGG[A/C]
CCCCCCGGGATAACACCAACAGGGACTAAAGATCGTAACTTTAGTCCCGGTTGGTGTTACCAACCGGGATTAAAGATCCCGGCAATCTTTAGCCCCGGTT

Reverse complement sequence

AACCGGGGCTAAAGATTGCCGGGATCTTTAATCCCGGTTGGTAACACCAACCGGGACTAAAGTTACGATCTTTAGTCCCTGTTGGTGTTATCCCGGGGGG[T/G]
CCTGCCAAGACCTGACAGCATTTGAACCGGGACAAAAGATGATCTTTAGTCCCGATTGTTGTTACCAACCGGGACTAAAGATCAAATATGCCCGTTACCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.60% 22.10% 0.25% 0.00% NA
All Indica  2759 96.20% 3.40% 0.36% 0.00% NA
All Japonica  1512 62.00% 37.90% 0.07% 0.00% NA
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 99.00% 0.20% 0.84% 0.00% NA
Indica II  465 97.60% 1.90% 0.43% 0.00% NA
Indica III  913 95.40% 4.60% 0.00% 0.00% NA
Indica Intermediate  786 94.10% 5.50% 0.38% 0.00% NA
Temperate Japonica  767 93.70% 6.30% 0.00% 0.00% NA
Tropical Japonica  504 26.80% 73.00% 0.20% 0.00% NA
Japonica Intermediate  241 34.90% 65.10% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013729406 A -> C LOC_Os10g26420.1 upstream_gene_variant ; 714.0bp to feature; MODIFIER silent_mutation Average:33.663; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg1013729406 A -> C LOC_Os10g26410-LOC_Os10g26420 intergenic_region ; MODIFIER silent_mutation Average:33.663; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013729406 NA 5.37E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013729406 NA 2.70E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 6.58E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 6.37E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 2.66E-72 mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 6.27E-09 6.34E-50 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 6.00E-06 1.99E-14 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 3.66E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 5.96E-78 mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 1.51E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 5.29E-08 1.03E-46 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 1.79E-15 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 7.36E-07 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 5.90E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 5.51E-09 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 2.28E-53 mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 8.33E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 4.54E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 6.63E-23 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 2.83E-06 NA mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 1.29E-13 3.00E-62 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 1.68E-07 2.54E-21 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 4.78E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 1.78E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 1.86E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 4.36E-11 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 8.31E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 1.76E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 7.05E-16 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 4.87E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 2.20E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 3.91E-13 9.07E-33 mr1980_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013729406 NA 4.76E-11 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251