Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013444607:

Variant ID: vg1013444607 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13444607
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, A: 0.30, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTGTTTGCGGAATAAGAATATAGCCTAAGGTCTTCCTCGAACCTGGTCTAGTCCTGGGTCTCGGTCTCACCTTAGCTCATCTAGGTTACAATACTGCT[C/A]
TGTGAAGAGAAGTGATGAGACCTATAAAAGCTATGTTTTATAAGAATGTAACACAAGGTTTGCCTCGAATCCGGCCTCGTCATGGGACCCGAGTTCGCAT

Reverse complement sequence

ATGCGAACTCGGGTCCCATGACGAGGCCGGATTCGAGGCAAACCTTGTGTTACATTCTTATAAAACATAGCTTTTATAGGTCTCATCACTTCTCTTCACA[G/T]
AGCAGTATTGTAACCTAGATGAGCTAAGGTGAGACCGAGACCCAGGACTAGACCAGGTTCGAGGAAGACCTTAGGCTATATTCTTATTCCGCAAACAGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.40%	21.70%	0.97%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	38.50%	58.50%	3.04%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.70%	1.30%	0.00%	0.00%	NA
Temperate Japonica	767	16.80%	77.70%	5.48%	0.00%	NA
Tropical Japonica	504	66.10%	33.70%	0.20%	0.00%	NA
Japonica Intermediate	241	49.80%	49.00%	1.24%	0.00%	NA
VI/Aromatic	96	20.80%	79.20%	0.00%	0.00%	NA
Intermediate	90	57.80%	42.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013444607	C -> A	LOC_Os10g25930.1	downstream_gene_variant ; 4969.0bp to feature; MODIFIER	silent_mutation	Average:59.396; most accessible tissue: Zhenshan97 root, score: 69.506	N	N	N	N
vg1013444607	C -> A	LOC_Os10g25940.1	downstream_gene_variant ; 420.0bp to feature; MODIFIER	silent_mutation	Average:59.396; most accessible tissue: Zhenshan97 root, score: 69.506	N	N	N	N
vg1013444607	C -> A	LOC_Os10g25950.1	downstream_gene_variant ; 4615.0bp to feature; MODIFIER	silent_mutation	Average:59.396; most accessible tissue: Zhenshan97 root, score: 69.506	N	N	N	N
vg1013444607	C -> A	LOC_Os10g25940-LOC_Os10g25950	intergenic_region ; MODIFIER	silent_mutation	Average:59.396; most accessible tissue: Zhenshan97 root, score: 69.506	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013444607	1.27E-07	5.37E-17	mr1324	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013444607	NA	1.38E-10	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013444607	7.72E-07	1.58E-14	mr1335	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013444607	NA	8.34E-07	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013444607	NA	4.88E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013444607	1.15E-06	2.75E-36	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013444607	NA	3.10E-09	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013444607	2.78E-06	1.70E-35	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013444607	NA	1.55E-11	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251