Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013382554:

Variant ID: vg1013382554 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13382554
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

TGCAGGGGCGACGGGCGGCAGGCGCGGAGGAGGAGACGGAGACGGTGGCGGTGACCGGTGTGGCGGTGCCTCCCCTTTCCTCCCTCTCCTTCCGACCGCC[G/A]
ATGAGGGGGAGGGGGGGGAGGTCGCGGAACTTCAGAAGGTGGCGGGATCTGTGGCTGTTGTGATATGATACGATGAGAGAGATGCTCTATATGTGGCATT

Reverse complement sequence

AATGCCACATATAGAGCATCTCTCTCATCGTATCATATCACAACAGCCACAGATCCCGCCACCTTCTGAAGTTCCGCGACCTCCCCCCCCTCCCCCTCAT[C/T]
GGCGGTCGGAAGGAGAGGGAGGAAAGGGGAGGCACCGCCACACCGGTCACCGCCACCGTCTCCGTCTCCTCCTCCGCGCCTGCCGCCCGTCGCCCCTGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	23.80%	4.49%	0.11%	NA
All Indica	2759	67.50%	25.00%	7.36%	0.18%	NA
All Japonica	1512	74.20%	25.50%	0.33%	0.00%	NA
Aus	269	90.70%	8.60%	0.74%	0.00%	NA
Indica I	595	81.00%	7.20%	11.26%	0.50%	NA
Indica II	465	73.80%	15.90%	10.32%	0.00%	NA
Indica III	913	57.60%	39.90%	2.41%	0.11%	NA
Indica Intermediate	786	65.00%	26.50%	8.40%	0.13%	NA
Temperate Japonica	767	94.80%	5.20%	0.00%	0.00%	NA
Tropical Japonica	504	50.60%	48.40%	0.99%	0.00%	NA
Japonica Intermediate	241	58.10%	41.90%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	3.10%	1.04%	0.00%	NA
Intermediate	90	72.20%	26.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013382554	G -> A	LOC_Os10g25810.1	downstream_gene_variant ; 4649.0bp to feature; MODIFIER	silent_mutation	Average:71.916; most accessible tissue: Callus, score: 87.098	N	N	N	N
vg1013382554	G -> A	LOC_Os10g25830.1	downstream_gene_variant ; 4784.0bp to feature; MODIFIER	silent_mutation	Average:71.916; most accessible tissue: Callus, score: 87.098	N	N	N	N
vg1013382554	G -> A	LOC_Os10g25810-LOC_Os10g25830	intergenic_region ; MODIFIER	silent_mutation	Average:71.916; most accessible tissue: Callus, score: 87.098	N	N	N	N
vg1013382554	G -> DEL	N	N	silent_mutation	Average:71.916; most accessible tissue: Callus, score: 87.098	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013382554	4.89E-11	1.12E-48	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554	2.78E-10	4.44E-19	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554	7.43E-12	2.52E-47	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554	2.49E-10	8.44E-25	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554	5.95E-17	5.70E-57	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554	NA	1.91E-08	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554	3.80E-12	1.40E-27	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554	1.93E-13	8.19E-31	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554	3.88E-06	2.96E-07	mr1980_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013382554	5.37E-06	2.81E-11	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251