RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1013275525:

Variant ID: vg1013275525 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13275525
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGTACATCGCTCGTACGCTTTCCTTTCGAGAGCATATGCATGCAGCTTCCCATTTCTTTATCTGTTTGTTACTGTTTCTAAATATTTTTAAAAATGTTT[G/A]
ACCGTTTATCTTATTTAGTAATTATTAATTTTTTTTATCATTTGATTTATTGTTAAATATAATTTTATGTACCCATATAGTTTTACATATTTCATAAAAA

Reverse complement sequence

TTTTTATGAAATATGTAAAACTATATGGGTACATAAAATTATATTTAACAATAAATCAAATGATAAAAAAAATTAATAATTACTAAATAAGATAAACGGT[C/T]
AAACATTTTTAAAAATATTTAGAAACAGTAACAAACAGATAAAGAAATGGGAAGCTGCATGCATATGCTCTCGAAAGGAAAGCGTACGAGCGATGTACGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.30%	7.30%	0.44%	0.00%	NA
All Indica	2759	98.20%	1.50%	0.29%	0.00%	NA
All Japonica	1512	90.80%	9.10%	0.07%	0.00%	NA
Aus	269	48.70%	47.20%	4.09%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.50%	1.30%	0.22%	0.00%	NA
Indica III	913	97.50%	2.30%	0.22%	0.00%	NA
Indica Intermediate	786	97.50%	1.90%	0.64%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	81.50%	18.50%	0.00%	0.00%	NA
Japonica Intermediate	241	82.20%	17.40%	0.41%	0.00%	NA
VI/Aromatic	96	71.90%	27.10%	1.04%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013275525	G -> A	LOC_Os10g25620.1	upstream_gene_variant ; 2578.0bp to feature; MODIFIER	silent_mutation	Average:62.904; most accessible tissue: Callus, score: 86.328	N	N	N	N
vg1013275525	G -> A	LOC_Os10g25630.1	downstream_gene_variant ; 2313.0bp to feature; MODIFIER	silent_mutation	Average:62.904; most accessible tissue: Callus, score: 86.328	N	N	N	N
vg1013275525	G -> A	LOC_Os10g25640.1	downstream_gene_variant ; 3828.0bp to feature; MODIFIER	silent_mutation	Average:62.904; most accessible tissue: Callus, score: 86.328	N	N	N	N
vg1013275525	G -> A	LOC_Os10g25620-LOC_Os10g25630	intergenic_region ; MODIFIER	silent_mutation	Average:62.904; most accessible tissue: Callus, score: 86.328	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013275525	NA	1.44E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275525	NA	4.77E-09	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275525	NA	1.43E-06	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275525	8.12E-09	9.46E-13	mr1058	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275525	NA	5.80E-08	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275525	1.37E-06	NA	mr1106	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275525	1.89E-06	NA	mr1115	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275525	8.76E-07	NA	mr1147	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275525	NA	4.38E-08	mr1153	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013275525	7.39E-06	7.98E-07	mr1196	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 73 entries

Previous1 2 3 4 5…8Next

Search for Variation information by Variation ID:

Detailed information for vg1013275525:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact