| Variant ID: vg1013263857 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13263857 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.73, T: 0.27, others allele: 0.00, population size: 163. )
GAGTTTATGCCAAACCCAACCTTGCATGCATGTTCACCAATAAAAACAAAGGAAGGAATAAACTAAACCATAAACCCCGGAGCGATCGAACTTTGGGACG[A/T]
TACAAATACAGCAACAAAAATTAACTTAAATTACATAATATTGTCTTAATTATTTCGATCCTGCGACGCCAAACTTGGTTTGGAGGAACCTCGTGAACGC
GCGTTCACGAGGTTCCTCCAAACCAAGTTTGGCGTCGCAGGATCGAAATAATTAAGACAATATTATGTAATTTAAGTTAATTTTTGTTGCTGTATTTGTA[T/A]
CGTCCCAAAGTTCGATCGCTCCGGGGTTTATGGTTTAGTTTATTCCTTCCTTTGTTTTTATTGGTGAACATGCATGCAAGGTTGGGTTTGGCATAAACTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.40% | 31.60% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 10.30% | 89.60% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 20.80% | 78.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 19.10% | 80.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 32.30% | 67.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013263857 | A -> T | LOC_Os10g25590.1 | 3_prime_UTR_variant ; 50.0bp to feature; MODIFIER | silent_mutation | Average:73.389; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg1013263857 | A -> T | LOC_Os10g25570.1 | upstream_gene_variant ; 4548.0bp to feature; MODIFIER | silent_mutation | Average:73.389; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg1013263857 | A -> T | LOC_Os10g25580.1 | upstream_gene_variant ; 2246.0bp to feature; MODIFIER | silent_mutation | Average:73.389; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg1013263857 | A -> T | LOC_Os10g25600.1 | upstream_gene_variant ; 1888.0bp to feature; MODIFIER | silent_mutation | Average:73.389; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg1013263857 | A -> T | LOC_Os10g25570.4 | upstream_gene_variant ; 4534.0bp to feature; MODIFIER | silent_mutation | Average:73.389; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg1013263857 | A -> T | LOC_Os10g25570.2 | upstream_gene_variant ; 4508.0bp to feature; MODIFIER | silent_mutation | Average:73.389; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg1013263857 | A -> T | LOC_Os10g25570.3 | upstream_gene_variant ; 4505.0bp to feature; MODIFIER | silent_mutation | Average:73.389; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg1013263857 | A -> T | LOC_Os10g25570.5 | upstream_gene_variant ; 4505.0bp to feature; MODIFIER | silent_mutation | Average:73.389; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013263857 | NA | 1.87E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013263857 | NA | 6.96E-103 | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013263857 | NA | 3.71E-102 | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013263857 | NA | 1.25E-75 | mr1014 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013263857 | NA | 4.90E-20 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013263857 | NA | 1.11E-26 | mr1024 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013263857 | NA | 2.03E-69 | mr1027 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013263857 | NA | 5.73E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013263857 | NA | 7.81E-11 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013263857 | NA | 7.22E-33 | mr1081 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/