Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012424922:

Variant ID: vg1012424922 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 12424922
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, C: 0.17, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:

CTACAGTTGTTAACAACATATAATCCTTATATCGATATAAATTTAAATCAAGTGATTGGGATAAATCGGTTGCCTTGCCGAGACAGTATAAATCACTTAG[A/C]
TCGAAATATATATTAACAACCGGATTATATATGTTTATAACATAGCCGATCAGATAGATCTAGCATGTATCGGCTAATACTCCGATACCACTCTATATTA

Reverse complement sequence

TAATATAGAGTGGTATCGGAGTATTAGCCGATACATGCTAGATCTATCTGATCGGCTATGTTATAAACATATATAATCCGGTTGTTAATATATATTTCGA[T/G]
CTAAGTGATTTATACTGTCTCGGCAAGGCAACCGATTTATCCCAATCACTTGATTTAAATTTATATCGATATAAGGATTATATGTTGTTAACAACTGTAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.90%	44.30%	0.30%	0.53%	NA
All Indica	2759	29.40%	69.20%	0.51%	0.83%	NA
All Japonica	1512	89.80%	10.10%	0.00%	0.07%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	7.40%	91.90%	0.34%	0.34%	NA
Indica II	465	37.00%	62.20%	0.00%	0.86%	NA
Indica III	913	33.40%	64.20%	1.10%	1.31%	NA
Indica Intermediate	786	37.00%	62.10%	0.25%	0.64%	NA
Temperate Japonica	767	97.70%	2.30%	0.00%	0.00%	NA
Tropical Japonica	504	81.00%	19.00%	0.00%	0.00%	NA
Japonica Intermediate	241	83.40%	16.20%	0.00%	0.41%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	68.90%	30.00%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1012424922	A -> C	LOC_Os10g24250.1	upstream_gene_variant ; 410.0bp to feature; MODIFIER	silent_mutation	Average:25.787; most accessible tissue: Minghui63 flag leaf, score: 38.911	N	N	N	N
vg1012424922	A -> C	LOC_Os10g24250-LOC_Os10g24260	intergenic_region ; MODIFIER	silent_mutation	Average:25.787; most accessible tissue: Minghui63 flag leaf, score: 38.911	N	N	N	N
vg1012424922	A -> DEL	N	N	silent_mutation	Average:25.787; most accessible tissue: Minghui63 flag leaf, score: 38.911	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1012424922	NA	1.75E-07	mr1328	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012424922	NA	8.71E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012424922	NA	6.05E-07	mr1446	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012424922	NA	3.78E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012424922	NA	2.49E-10	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012424922	8.43E-09	NA	mr1446_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012424922	8.74E-08	1.35E-10	mr1446_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012424922	NA	4.73E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251