Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012400571:

Variant ID: vg1012400571 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 12400571
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.51, T: 0.47, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

ACTTGATTTAAGTATATATCGACATGGGTATTATATATTGTCAATATCTACAGCCGATCAAGTAGATTTAGTTCTTTCTTACTTATTTATGACTGCCGAT[T/C]
GATGCATACATGACATCGGCTCAAAGATAAATTATATGTCATCGGCATTTAGCCGATCGACTATCATTTATATGATTAATCGCGGTTTCTTTATCTTTGT

Reverse complement sequence

ACAAAGATAAAGAAACCGCGATTAATCATATAAATGATAGTCGATCGGCTAAATGCCGATGACATATAATTTATCTTTGAGCCGATGTCATGTATGCATC[A/G]
ATCGGCAGTCATAAATAAGTAAGAAAGAACTAAATCTACTTGATCGGCTGTAGATATTGACAATATATAATACCCATGTCGATATATACTTAAATCAAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.00%	29.80%	0.38%	7.85%	NA
All Indica	2759	97.40%	0.80%	0.29%	1.52%	NA
All Japonica	1512	10.80%	88.60%	0.00%	0.53%	NA
Aus	269	10.00%	1.90%	2.23%	85.87%	NA
Indica I	595	99.50%	0.20%	0.34%	0.00%	NA
Indica II	465	98.10%	1.10%	0.00%	0.86%	NA
Indica III	913	97.20%	0.40%	0.22%	2.19%	NA
Indica Intermediate	786	95.80%	1.40%	0.51%	2.29%	NA
Temperate Japonica	767	2.90%	96.90%	0.00%	0.26%	NA
Tropical Japonica	504	19.80%	80.20%	0.00%	0.00%	NA
Japonica Intermediate	241	17.40%	80.10%	0.00%	2.49%	NA
VI/Aromatic	96	8.30%	7.30%	3.12%	81.25%	NA
Intermediate	90	47.80%	37.80%	1.11%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1012400571	T -> C	LOC_Os10g24200.1	upstream_gene_variant ; 2113.0bp to feature; MODIFIER	silent_mutation	Average:32.827; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg1012400571	T -> C	LOC_Os10g24210.1	upstream_gene_variant ; 4048.0bp to feature; MODIFIER	silent_mutation	Average:32.827; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg1012400571	T -> C	LOC_Os10g24200-LOC_Os10g24210	intergenic_region ; MODIFIER	silent_mutation	Average:32.827; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg1012400571	T -> DEL	N	N	silent_mutation	Average:32.827; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1012400571	NA	9.72E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	2.33E-09	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	2.70E-21	mr1416	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	3.90E-48	mr1519	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	1.73E-07	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	1.23E-42	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	1.02E-26	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	6.40E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	1.17E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	2.69E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	3.37E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	2.10E-27	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	4.92E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	1.93E-32	mr1102_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	1.14E-10	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	2.71E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	1.21E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	1.59E-37	mr1223_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	1.37E-06	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	2.81E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	3.66E-21	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	2.40E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	9.45E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	6.00E-16	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	1.30E-11	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	2.33E-07	1.28E-09	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	3.64E-22	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	1.51E-21	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	2.25E-15	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	4.02E-35	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	1.39E-07	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	9.46E-23	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	6.71E-06	9.34E-25	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	4.84E-06	NA	mr1934_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	1.68E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	4.23E-44	mr1944_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	3.71E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012400571	NA	3.04E-11	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251