Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011718495:

Variant ID: vg1011718495 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11718495
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.11, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


GCCACATCAGCGTCTAGCCAACACGAGTGGACCGGGTCAAATTTGCCACATATAGACACTTGGTTTTGCTGACTAAATTGGATGGTTTTATATAGTTTAG[A/G]
GGTGAAGATTTCTGGTATTGAGGATAAGGGATGTCAAATAAACTCGATGTTAAGTTGAGGCACGGCTGGTGAACTTATTCCTTTGGCAATATATGGACAA

Reverse complement sequence

TTGTCCATATATTGCCAAAGGAATAAGTTCACCAGCCGTGCCTCAACTTAACATCGAGTTTATTTGACATCCCTTATCCTCAATACCAGAAATCTTCACC[T/C]
CTAAACTATATAAAACCATCCAATTTAGTCAGCAAAACCAAGTGTCTATATGTGGCAAATTTGACCCGGTCCACTCGTGTTGGCTAGACGCTGATGTGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.70% 48.10% 0.17% 0.00% NA
All Indica  2759 62.50% 37.30% 0.22% 0.00% NA
All Japonica  1512 21.10% 78.80% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 76.60% 23.20% 0.17% 0.00% NA
Indica II  465 56.30% 43.20% 0.43% 0.00% NA
Indica III  913 58.20% 41.70% 0.11% 0.00% NA
Indica Intermediate  786 60.30% 39.40% 0.25% 0.00% NA
Temperate Japonica  767 18.60% 81.40% 0.00% 0.00% NA
Tropical Japonica  504 28.20% 71.60% 0.20% 0.00% NA
Japonica Intermediate  241 14.10% 85.50% 0.41% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011718495 A -> G LOC_Os10g22570.1 upstream_gene_variant ; 4937.0bp to feature; MODIFIER silent_mutation Average:89.382; most accessible tissue: Minghui63 root, score: 94.668 N N N N
vg1011718495 A -> G LOC_Os10g22580.1 upstream_gene_variant ; 628.0bp to feature; MODIFIER silent_mutation Average:89.382; most accessible tissue: Minghui63 root, score: 94.668 N N N N
vg1011718495 A -> G LOC_Os10g22590.1 upstream_gene_variant ; 4924.0bp to feature; MODIFIER silent_mutation Average:89.382; most accessible tissue: Minghui63 root, score: 94.668 N N N N
vg1011718495 A -> G LOC_Os10g22580-LOC_Os10g22590 intergenic_region ; MODIFIER silent_mutation Average:89.382; most accessible tissue: Minghui63 root, score: 94.668 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1011718495 A G 0.01 0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011718495 NA 2.22E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011718495 3.44E-06 NA mr1771 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251