Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011645008:

Variant ID: vg1011645008 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11645008
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTCTCACTATGATTCTGAATGTTTTCTTCTTCTTTTGTCTCATTGTGTTTCTGAATGTGTTCTCAATTTCTCACAGTGTGTTCTGAATGATCTCTCTG[T/A]
ACTCCGATCCACCCATTTTTCAGTGCTTGGTGGATTTATGATTTTTATGATCCTCGGAAAATAATGCACTATAATGTTAAATTATGGTATCGCTCAGTAT

Reverse complement sequence

ATACTGAGCGATACCATAATTTAACATTATAGTGCATTATTTTCCGAGGATCATAAAAATCATAAATCCACCAAGCACTGAAAAATGGGTGGATCGGAGT[A/T]
CAGAGAGATCATTCAGAACACACTGTGAGAAATTGAGAACACATTCAGAAACACAATGAGACAAAAGAAGAAGAAAACATTCAGAATCATAGTGAGACAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.90%	11.00%	0.02%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.04%	0.00%	NA
All Japonica	1512	66.90%	33.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.50%	0.17%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	39.40%	60.60%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	86.70%	13.30%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011645008	T -> A	LOC_Os10g22484.1	downstream_gene_variant ; 4661.0bp to feature; MODIFIER	silent_mutation	Average:58.175; most accessible tissue: Callus, score: 89.466	N	N	N	N
vg1011645008	T -> A	LOC_Os10g22484.2	downstream_gene_variant ; 4665.0bp to feature; MODIFIER	silent_mutation	Average:58.175; most accessible tissue: Callus, score: 89.466	N	N	N	N
vg1011645008	T -> A	LOC_Os10g22460-LOC_Os10g22484	intergenic_region ; MODIFIER	silent_mutation	Average:58.175; most accessible tissue: Callus, score: 89.466	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011645008	NA	2.32E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011645008	NA	2.37E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011645008	NA	2.64E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011645008	NA	4.20E-06	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011645008	NA	7.66E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011645008	NA	8.28E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011645008	NA	8.74E-12	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011645008	NA	3.24E-06	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011645008	3.21E-06	NA	mr1932	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251