Search for Variation information by Variation ID:
Detailed information for vg1011430123:
| Variant ID: vg1011430123 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 11430123 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.03, others allele: 0.00, population size: 182. )
Flanking Sequence (100 bp) in Reference Genome:
CAAGCCTCAACATTGATGTGACAGTTATACCGCATAAGCAGTCCAGGATTATATGGGATCACCCACCTATTGTCTAACACTGCACCTCTAATCTTGACAC[A/G]
CCATCCGTCATTTCTCCTCCTGTACAAATGGTACGAGTCCTTCCCTTGTTGTGTTGCTTGGTTGAACTGTCGAGGAAAGTCAAAGGGACACACTCCATCC
Reverse complement sequence
GGATGGAGTGTGTCCCTTTGACTTTCCTCGACAGTTCAACCAAGCAACACAACAAGGGAAGGACTCGTACCATTTGTACAGGAGGAGAAATGACGGATGG[T/C]
GTGTCAAGATTAGAGGTGCAGTGTTAGACAATAGGTGGGTGATCCCATATAATCCTGGACTGCTTATGCGGTATAACTGTCACATCAATGTTGAGGCTTG
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.50% | 1.20% | 10.96% | 53.34% | NA |
| All Indica | 2759 | 36.70% | 0.10% | 14.46% | 48.79% | NA |
| All Japonica | 1512 | 37.60% | 3.40% | 4.96% | 54.10% | NA |
| Aus | 269 | 0.70% | 0.40% | 10.78% | 88.10% | NA |
| Indica I | 595 | 43.20% | 0.20% | 16.47% | 40.17% | NA |
| Indica II | 465 | 21.70% | 0.00% | 15.27% | 63.01% | NA |
| Indica III | 913 | 41.90% | 0.10% | 13.25% | 44.69% | NA |
| Indica Intermediate | 786 | 34.50% | 0.00% | 13.87% | 51.65% | NA |
| Temperate Japonica | 767 | 69.10% | 6.50% | 0.39% | 23.99% | NA |
| Tropical Japonica | 504 | 3.20% | 0.20% | 11.90% | 84.72% | NA |
| Japonica Intermediate | 241 | 9.10% | 0.00% | 4.98% | 85.89% | NA |
| VI/Aromatic | 96 | 12.50% | 0.00% | 6.25% | 81.25% | NA |
| Intermediate | 90 | 38.90% | 4.40% | 10.00% | 46.67% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1011430123 | A -> G | LOC_Os10g22130.1 | missense_variant ; p.Cys201Arg; MODERATE | nonsynonymous_codon ; C201R | Average:12.169; most accessible tissue: Callus, score: 43.788 | benign  |
-0.567 |
TOLERATED | 0.58 |
| vg1011430123 | A -> DEL | LOC_Os10g22130.1 | N | frameshift_variant | Average:12.169; most accessible tissue: Callus, score: 43.788 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1011430123 | NA | 4.24E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011430123 | NA | 7.16E-06 | mr1068_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011430123 | NA | 9.13E-07 | mr1078_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011430123 | NA | 7.35E-06 | mr1112_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011430123 | NA | 1.77E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011430123 | 3.86E-06 | 3.86E-06 | mr1377_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |