RiceVarMap2

Detailed information for vg1011000041:

Variant ID: vg1011000041 (JBrowse)

Variation Type: SNP

Chromosome: chr10

Position: 11000041

Reference Allele: T

Alternative Allele: C

Primary Allele: T

Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAAGGGCAAACTTGTTTTTATTTAGTGTTTCTCTCTCCAAATTCACGAGAAATAATAAAATAAGGCCCCGAGTGTCCAGGAGCTAATTACACGTTTTTTG[T/C]
GATGCCCGTTAGCAAATTCTTGTTCTTGCGGTGTCCACAAACTAATTACACGTTTTTTCGATGCCCTATAGCAAATTTTGCCTAAAATAAAGTTTGTGTA

Reverse complement sequence

TACACAAACTTTATTTTAGGCAAAATTTGCTATAGGGCATCGAAAAAACGTGTAATTAGTTTGTGGACACCGCAAGAACAAGAATTTGCTAACGGGCATC[A/G]
CAAAAAACGTGTAATTAGCTCCTGGACACTCGGGGCCTTATTTTATTATTTCTCGTGAATTTGGAGAGAGAAACACTAAATAAAAACAAGTTTGCCCTTG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.90%	0.70%	1.50%	37.92%	NA
All Indica	2759	32.50%	1.20%	2.50%	63.75%	NA
All Japonica	1512	99.10%	0.00%	0.07%	0.79%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	26.70%	1.00%	2.86%	69.41%	NA
Indica II	465	16.80%	1.50%	2.58%	79.14%	NA
Indica III	913	40.10%	1.60%	2.63%	55.64%	NA
Indica Intermediate	786	37.50%	0.60%	2.04%	59.80%	NA
Temperate Japonica	767	99.60%	0.00%	0.00%	0.39%	NA
Tropical Japonica	504	98.60%	0.00%	0.20%	1.19%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	76.70%	1.10%	1.11%	21.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011000041	T -> C	LOC_Os10g21470.1	upstream_gene_variant ; 2656.0bp to feature; MODIFIER	silent_mutation	Average:17.041; most accessible tissue: Callus, score: 82.201	N	N	N	N
vg1011000041	T -> C	LOC_Os10g21470.2	upstream_gene_variant ; 2656.0bp to feature; MODIFIER	silent_mutation	Average:17.041; most accessible tissue: Callus, score: 82.201	N	N	N	N
vg1011000041	T -> C	LOC_Os10g21479.1	downstream_gene_variant ; 3013.0bp to feature; MODIFIER	silent_mutation	Average:17.041; most accessible tissue: Callus, score: 82.201	N	N	N	N
vg1011000041	T -> C	LOC_Os10g21470-LOC_Os10g21479	intergenic_region ; MODIFIER	silent_mutation	Average:17.041; most accessible tissue: Callus, score: 82.201	N	N	N	N
vg1011000041	T -> DEL	N	N	silent_mutation	Average:17.041; most accessible tissue: Callus, score: 82.201	N	N	N	N

Showing 1 to 5 of 5 entries

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011000041	NA	1.46E-06	mr1126	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg1011000041:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact