Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010636917:

Variant ID: vg1010636917 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10636917
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.08, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


CCATTTATATAAGCTCATAACATGGTTTTGCATAATTATTTTTATCTAATTTGTACTTTCTCTGTTTCATAATGTAAGTCATTCTAGTATTTTCTACATT[C/T]
ATATTGATGTTAATGAATCTAGACACGTTAATATGAATGTAGAAAATGCTAAAATGACTTATATTGTGAAACGGAGGAAGTATATAATTTAGTTGAGTTT

Reverse complement sequence

AAACTCAACTAAATTATATACTTCCTCCGTTTCACAATATAAGTCATTTTAGCATTTTCTACATTCATATTAACGTGTCTAGATTCATTAACATCAATAT[G/A]
AATGTAGAAAATACTAGAATGACTTACATTATGAAACAGAGAAAGTACAAATTAGATAAAAATAATTATGCAAAACCATGTTATGAGCTTATATAAATGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.00% 12.00% 0.02% 0.00% NA
All Indica  2759 96.50% 3.50% 0.00% 0.00% NA
All Japonica  1512 92.50% 7.50% 0.00% 0.00% NA
Aus  269 3.00% 97.00% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 96.80% 3.20% 0.00% 0.00% NA
Indica Intermediate  786 93.50% 6.50% 0.00% 0.00% NA
Temperate Japonica  767 87.20% 12.80% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 19.80% 80.20% 0.00% 0.00% NA
Intermediate  90 77.80% 21.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010636917 C -> T LOC_Os10g21000.1 downstream_gene_variant ; 452.0bp to feature; MODIFIER silent_mutation Average:54.942; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg1010636917 C -> T LOC_Os10g20990-LOC_Os10g21000 intergenic_region ; MODIFIER silent_mutation Average:54.942; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010636917 NA 3.05E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 NA 4.93E-14 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 2.43E-08 6.48E-32 mr1210 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 NA 2.23E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 3.16E-08 2.05E-36 mr1305 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 NA 2.64E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 NA 2.24E-15 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 NA 2.04E-12 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 6.66E-09 1.02E-18 mr1585 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 9.48E-06 6.34E-09 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 4.31E-10 1.82E-38 mr1586 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 NA 6.67E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 NA 2.90E-23 mr1765 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 NA 7.76E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 NA 1.08E-17 mr1911 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 NA 6.61E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 NA 9.78E-11 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 2.15E-06 3.76E-29 mr1305_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 NA 3.55E-16 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 NA 3.04E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 NA 4.29E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 6.56E-09 1.55E-15 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 NA 2.32E-08 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 NA 1.60E-09 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010636917 NA 4.97E-10 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251