Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010595641:

Variant ID: vg1010595641 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10595641
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTGGTCAACAAAATTAAGAAGCTTGAAGGAGCCAGGGATGAAGTTGCCAACGCCGCTACACCACTCATCCAAGCCATGTTTTTTTAATAATAATGGTC[T/C]
GAGTTCGTTCGACGCTATTGAAACTTCGACAAGCTGAGAGCTGCTTCGGATACATACTTTAAGAACATCAAAGAAGCTGGATGCATGGGGGCGAGCATGG

Reverse complement sequence

CCATGCTCGCCCCCATGCATCCAGCTTCTTTGATGTTCTTAAAGTATGTATCCGAAGCAGCTCTCAGCTTGTCGAAGTTTCAATAGCGTCGAACGAACTC[A/G]
GACCATTATTATTAAAAAAACATGGCTTGGATGAGTGGTGTAGCGGCGTTGGCAACTTCATCCCTGGCTCCTTCAAGCTTCTTAATTTTGTTGACCAAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.00%	21.60%	1.54%	6.79%	NA
All Indica	2759	97.40%	1.10%	1.38%	0.07%	NA
All Japonica	1512	14.40%	63.60%	1.92%	20.04%	NA
Aus	269	97.80%	0.00%	0.00%	2.23%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	94.50%	2.00%	3.50%	0.00%	NA
Indica Intermediate	786	98.10%	0.90%	0.76%	0.25%	NA
Temperate Japonica	767	15.50%	80.30%	0.00%	4.17%	NA
Tropical Japonica	504	5.80%	47.00%	5.16%	42.06%	NA
Japonica Intermediate	241	29.00%	45.20%	1.24%	24.48%	NA
VI/Aromatic	96	89.60%	3.10%	3.12%	4.17%	NA
Intermediate	90	61.10%	28.90%	3.33%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010595641	T -> C	LOC_Os10g20910.1	upstream_gene_variant ; 4231.0bp to feature; MODIFIER	silent_mutation	Average:28.679; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N
vg1010595641	T -> C	LOC_Os10g20920.1	downstream_gene_variant ; 82.0bp to feature; MODIFIER	silent_mutation	Average:28.679; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N
vg1010595641	T -> C	LOC_Os10g20930.1	downstream_gene_variant ; 843.0bp to feature; MODIFIER	silent_mutation	Average:28.679; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N
vg1010595641	T -> C	LOC_Os10g20920-LOC_Os10g20930	intergenic_region ; MODIFIER	silent_mutation	Average:28.679; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N
vg1010595641	T -> DEL	N	N	silent_mutation	Average:28.679; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010595641	NA	2.84E-08	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010595641	NA	6.29E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010595641	NA	1.04E-19	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010595641	NA	1.65E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010595641	1.23E-06	1.75E-11	mr1660_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010595641	6.93E-06	1.94E-06	mr1660_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010595641	NA	5.14E-08	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010595641	NA	3.98E-10	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251