Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010544331:

Variant ID: vg1010544331 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10544331
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:

CCATTTTTTATCGTGGACACTAATTTTGAGACCCTCAGCCTATTGGCATGATAGTTGGGCCCATTTGGAGTTGTTTACTTGACTTATGGGGCCTCCAATC[C/T]
GTGTAAATGTATCCTGAATGCGCGGAGGTGCAGTTTGTTGCTTGACGGATGTGTTTTCTTCTCAAAATACCTGCATACACATATTTCACCAACACTAGTG

Reverse complement sequence

CACTAGTGTTGGTGAAATATGTGTATGCAGGTATTTTGAGAAGAAAACACATCCGTCAAGCAACAAACTGCACCTCCGCGCATTCAGGATACATTTACAC[G/A]
GATTGGAGGCCCCATAAGTCAAGTAAACAACTCCAAATGGGCCCAACTATCATGCCAATAGGCTGAGGGTCTCAAAATTAGTGTCCACGATAAAAAATGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.20%	2.10%	4.46%	69.28%	NA
All Indica	2759	4.20%	3.20%	5.55%	87.10%	NA
All Japonica	1512	63.30%	0.10%	0.86%	35.71%	NA
Aus	269	7.10%	2.20%	13.75%	76.95%	NA
Indica I	595	5.90%	1.70%	3.36%	89.08%	NA
Indica II	465	3.20%	4.70%	6.24%	85.81%	NA
Indica III	913	3.50%	3.50%	5.81%	87.19%	NA
Indica Intermediate	786	4.20%	3.10%	6.49%	86.26%	NA
Temperate Japonica	767	77.70%	0.00%	1.17%	21.12%	NA
Tropical Japonica	504	48.20%	0.40%	0.79%	50.60%	NA
Japonica Intermediate	241	49.00%	0.00%	0.00%	51.04%	NA
VI/Aromatic	96	18.80%	0.00%	2.08%	79.17%	NA
Intermediate	90	36.70%	3.30%	6.67%	53.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010544331	C -> T	LOC_Os10g20780.1	upstream_gene_variant ; 1171.0bp to feature; MODIFIER	silent_mutation	Average:13.072; most accessible tissue: Callus, score: 20.325	N	N	N	N
vg1010544331	C -> T	LOC_Os10g20794.1	upstream_gene_variant ; 3281.0bp to feature; MODIFIER	silent_mutation	Average:13.072; most accessible tissue: Callus, score: 20.325	N	N	N	N
vg1010544331	C -> T	LOC_Os10g20780-LOC_Os10g20794	intergenic_region ; MODIFIER	silent_mutation	Average:13.072; most accessible tissue: Callus, score: 20.325	N	N	N	N
vg1010544331	C -> DEL	N	N	silent_mutation	Average:13.072; most accessible tissue: Callus, score: 20.325	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010544331	NA	1.14E-08	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010544331	NA	4.53E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010544331	1.89E-06	3.96E-08	mr1818	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010544331	NA	1.25E-06	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251