Search for Variation information by Variation ID:
Detailed information for vg1010518357:
| Variant ID: vg1010518357 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10518357 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 43. )
Flanking Sequence (100 bp) in Reference Genome:
CCTTTGATTGATCCAAAATCATATTGAGGTTCTTTTTACCATCAGAAAATCTTAACAAAGAATTTTTCAAATAAGAAACCTCTTTTTCCAAATTAGCACA[A/T]
TTTGCATAATCTACCATGACACCTTTGCTTTTACGACATTTAGGGCAAGAAAGCACTTCATTATTTTTCACAACATCTTCCATGAACTCAACACGACCTA
Reverse complement sequence
TAGGTCGTGTTGAGTTCATGGAAGATGTTGTGAAAAATAATGAAGTGCTTTCTTGCCCTAAATGTCGTAAAAGCAAAGGTGTCATGGTAGATTATGCAAA[T/A]
TGTGCTAATTTGGAAAAAGAGGTTTCTTATTTGAAAAATTCTTTGTTAAGATTTTCTGATGGTAAAAAGAACCTCAATATGATTTTGGATCAATCAAAGG
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 14.50% | 7.10% | 1.23% | 77.17% | NA |
| All Indica | 2759 | 1.10% | 0.70% | 1.27% | 96.92% | NA |
| All Japonica | 1512 | 40.80% | 20.40% | 1.19% | 37.63% | NA |
| Aus | 269 | 0.40% | 0.00% | 0.00% | 99.63% | NA |
| Indica I | 595 | 0.80% | 0.70% | 2.02% | 96.47% | NA |
| Indica II | 465 | 1.30% | 0.00% | 0.86% | 97.85% | NA |
| Indica III | 913 | 1.20% | 0.90% | 1.10% | 96.82% | NA |
| Indica Intermediate | 786 | 1.00% | 1.00% | 1.15% | 96.82% | NA |
| Temperate Japonica | 767 | 69.40% | 5.30% | 1.04% | 24.25% | NA |
| Tropical Japonica | 504 | 4.80% | 42.30% | 1.39% | 51.59% | NA |
| Japonica Intermediate | 241 | 25.30% | 22.40% | 1.24% | 51.04% | NA |
| VI/Aromatic | 96 | 14.60% | 0.00% | 3.12% | 82.29% | NA |
| Intermediate | 90 | 24.40% | 10.00% | 2.22% | 63.33% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010518357 | A -> T | LOC_Os10g20750.1 | missense_variant ; p.Asn410Lys; MODERATE | nonsynonymous_codon | Average:5.593; most accessible tissue: Minghui63 root, score: 10.708 | benign  |
1.134 |
DELETERIOUS | 0.02 |
| vg1010518357 | A -> DEL | LOC_Os10g20750.1 | N | frameshift_variant | Average:5.593; most accessible tissue: Minghui63 root, score: 10.708 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010518357 | NA | 2.86E-06 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010518357 | NA | 4.43E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010518357 | NA | 2.08E-13 | mr1771 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010518357 | NA | 5.90E-14 | mr1784 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010518357 | NA | 6.24E-06 | mr1800 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010518357 | NA | 7.23E-09 | mr1800 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010518357 | NA | 1.41E-07 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |