Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010255814:

Variant ID: vg1010255814 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10255814
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TAATCTTGTTTACACCCAAATTTGGCACCTAGGAGTAAGATAGGAAAAATTGCCAAATTTTAGAAATCTGCCGGTTTCCTCCGAGTAGGCCAGTCTGACC[G/A]
CCGTGTGTTGGCCGGTCAGACCGCCGGTTGAGGGCCGGTCAGACCAGCGGCATGTGGATGGTCTGACCGGCAGGTCCGAGTCCGAGTGTGTGTTTCGCCG

Reverse complement sequence

CGGCGAAACACACACTCGGACTCGGACCTGCCGGTCAGACCATCCACATGCCGCTGGTCTGACCGGCCCTCAACCGGCGGTCTGACCGGCCAACACACGG[C/T]
GGTCAGACTGGCCTACTCGGAGGAAACCGGCAGATTTCTAAAATTTGGCAATTTTTCCTATCTTACTCCTAGGTGCCAAATTTGGGTGTAAACAAGATTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.10%	37.20%	0.40%	0.21%	NA
All Indica	2759	60.90%	38.30%	0.51%	0.33%	NA
All Japonica	1512	78.40%	21.50%	0.00%	0.07%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	77.50%	22.00%	0.34%	0.17%	NA
Indica II	465	50.30%	48.40%	0.86%	0.43%	NA
Indica III	913	52.50%	46.40%	0.55%	0.55%	NA
Indica Intermediate	786	64.40%	35.10%	0.38%	0.13%	NA
Temperate Japonica	767	94.80%	5.20%	0.00%	0.00%	NA
Tropical Japonica	504	57.50%	42.50%	0.00%	0.00%	NA
Japonica Intermediate	241	70.10%	29.50%	0.00%	0.41%	NA
VI/Aromatic	96	15.60%	83.30%	1.04%	0.00%	NA
Intermediate	90	58.90%	36.70%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010255814	G -> A	LOC_Os10g20390.1	upstream_gene_variant ; 3252.0bp to feature; MODIFIER	silent_mutation	Average:59.414; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg1010255814	G -> A	LOC_Os10g20400.1	upstream_gene_variant ; 2972.0bp to feature; MODIFIER	silent_mutation	Average:59.414; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg1010255814	G -> A	LOC_Os10g20390-LOC_Os10g20400	intergenic_region ; MODIFIER	silent_mutation	Average:59.414; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg1010255814	G -> DEL	N	N	silent_mutation	Average:59.414; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010255814	NA	3.11E-11	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814	NA	1.13E-11	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814	NA	1.05E-09	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814	NA	1.51E-06	mr1261	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814	NA	7.39E-12	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814	7.49E-07	1.39E-07	mr1729	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814	NA	7.09E-07	mr1729	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814	NA	3.70E-14	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814	NA	4.20E-13	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010255814	NA	1.90E-15	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251