Variant ID: vg1009983410 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 9983410 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATTTAAAAACCTTCTTTTGACTAAGATTCTTTTATTCAAATTTAGTTTGAAAACTCTTTCTATTTTTTTATGAATTATGGTCCAAGAAACCTTCCCATA[T/C]
TGTCCTAGAACCTAAAACAAAGTAATTCCAATTTTATTGGAATTAATTGTTAGCCCATTCTTTGATCTTAAACCCATCCTTTGATTCTCGATCTAAATGT
ACATTTAGATCGAGAATCAAAGGATGGGTTTAAGATCAAAGAATGGGCTAACAATTAATTCCAATAAAATTGGAATTACTTTGTTTTAGGTTCTAGGACA[A/G]
TATGGGAAGGTTTCTTGGACCATAATTCATAAAAAAATAGAAAGAGTTTTCAAACTAAATTTGAATAAAAGAATCTTAGTCAAAAGAAGGTTTTTAAATT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 80.00% | 20.00% | 0.02% | 0.00% | NA |
All Indica | 2759 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 40.70% | 59.20% | 0.07% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
Indica III | 913 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 18.60% | 81.40% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 64.90% | 35.10% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 60.60% | 39.00% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1009983410 | T -> C | LOC_Os10g19914.1 | upstream_gene_variant ; 3680.0bp to feature; MODIFIER | silent_mutation | Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
vg1009983410 | T -> C | LOC_Os10g19919.1 | upstream_gene_variant ; 1017.0bp to feature; MODIFIER | silent_mutation | Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
vg1009983410 | T -> C | LOC_Os10g19919.2 | upstream_gene_variant ; 1017.0bp to feature; MODIFIER | silent_mutation | Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
vg1009983410 | T -> C | LOC_Os10g19919.3 | upstream_gene_variant ; 1017.0bp to feature; MODIFIER | silent_mutation | Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
vg1009983410 | T -> C | LOC_Os10g19919.4 | upstream_gene_variant ; 1017.0bp to feature; MODIFIER | silent_mutation | Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
vg1009983410 | T -> C | LOC_Os10g19914-LOC_Os10g19919 | intergenic_region ; MODIFIER | silent_mutation | Average:23.429; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1009983410 | NA | 4.83E-06 | mr1318 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1009983410 | NA | 2.79E-36 | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1009983410 | NA | 1.56E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1009983410 | 1.35E-06 | 1.12E-10 | mr1624 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1009983410 | 8.83E-06 | 3.78E-09 | mr1624 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1009983410 | NA | 6.15E-08 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1009983410 | NA | 3.53E-17 | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1009983410 | NA | 4.91E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1009983410 | NA | 8.02E-07 | mr1110_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1009983410 | NA | 5.63E-45 | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1009983410 | NA | 4.82E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1009983410 | NA | 2.87E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1009983410 | NA | 5.71E-27 | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1009983410 | NA | 1.40E-13 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |