Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009644609:

Variant ID: vg1009644609 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9644609
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, T: 0.34, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

GTTGGCCTTGGATAGTCTTAGCCTTAGGTAGATTACATACGTTCCCTGCGTTCGATATCCTTTTGGGGTCACCCGAAGGTGAAGTGCTACAGCGGTATTC[T/C]
GTGCGCTTGCGGATTTATCTGTGGTCGTAAGGAATACCAACAATAAGGAGCGTGATATAAGTGTTGAAGTTACTGTACACTGCTCCTTGATCGTCTTTTT

Reverse complement sequence

AAAAAGACGATCAAGGAGCAGTGTACAGTAACTTCAACACTTATATCACGCTCCTTATTGTTGGTATTCCTTACGACCACAGATAAATCCGCAAGCGCAC[A/G]
GAATACCGCTGTAGCACTTCACCTTCGGGTGACCCCAAAAGGATATCGAACGCAGGGAACGTATGTAATCTACCTAAGGCTAAGACTATCCAAGGCCAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.60%	25.00%	0.55%	31.85%	NA
All Indica	2759	56.70%	5.60%	0.47%	37.22%	NA
All Japonica	1512	24.20%	45.60%	0.66%	29.50%	NA
Aus	269	11.90%	86.20%	0.37%	1.49%	NA
Indica I	595	72.60%	3.40%	0.67%	23.36%	NA
Indica II	465	40.60%	3.20%	0.86%	55.27%	NA
Indica III	913	61.10%	4.30%	0.11%	34.50%	NA
Indica Intermediate	786	49.10%	10.20%	0.51%	40.20%	NA
Temperate Japonica	767	17.60%	55.10%	0.39%	26.86%	NA
Tropical Japonica	504	22.40%	33.70%	1.39%	42.46%	NA
Japonica Intermediate	241	49.00%	40.20%	0.00%	10.79%	NA
VI/Aromatic	96	19.80%	78.10%	1.04%	1.04%	NA
Intermediate	90	33.30%	35.60%	1.11%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009644609	T -> C	LOC_Os10g18940.1	missense_variant ; p.Gln533Arg; MODERATE	nonsynonymous_codon ; Q533W	Average:42.463; most accessible tissue: Minghui63 flag leaf, score: 65.44	unknown	unknown	DELETERIOUS	0.00
vg1009644609	T -> C	LOC_Os10g18940.1	missense_variant ; p.Gln533Arg; MODERATE	nonsynonymous_codon ; Q533R	Average:42.463; most accessible tissue: Minghui63 flag leaf, score: 65.44	unknown	unknown	TOLERATED	0.55
vg1009644609	T -> DEL	LOC_Os10g18940.1	N	frameshift_variant	Average:42.463; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009644609	1.27E-06	NA	mr1053	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609	2.16E-07	1.35E-07	mr1053	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609	1.57E-07	NA	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609	NA	5.81E-06	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609	5.75E-06	NA	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609	4.80E-06	4.58E-07	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609	3.41E-06	NA	mr1147	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609	NA	8.03E-06	mr1346	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609	NA	3.52E-06	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609	NA	3.47E-08	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609	NA	1.54E-09	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609	NA	9.89E-06	mr1772	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609	NA	5.55E-09	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609	NA	3.40E-06	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609	NA	7.94E-06	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609	NA	3.97E-06	mr1691_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609	NA	2.36E-11	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609	NA	1.59E-10	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251