Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009642237:

Variant ID: vg1009642237 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9642237
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:

AAACCAACCAGTTTGGCCGAACCCATTCTGCGGCCGTTCACTGTTTGCTTCCACGTGAACTCAAGCTAGGGATGGTACAACTAGAGTTCATGGTCTCCCT[G/A]
AAAATGACATGCATGCCTATTTTTCTTTGCTCATTACCTGTTGCTTGTGGTGATATATCCAATAGGGACCCCATGCTATCTAGGTAATTGATGAATAAGA

Reverse complement sequence

TCTTATTCATCAATTACCTAGATAGCATGGGGTCCCTATTGGATATATCACCACAAGCAACAGGTAATGAGCAAAGAAAAATAGGCATGCATGTCATTTT[C/T]
AGGGAGACCATGAACTCTAGTTGTACCATCCCTAGCTTGAGTTCACGTGGAAGCAAACAGTGAACGGCCGCAGAATGGGTTCGGCCAAACTGGTTGGTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.20%	28.50%	0.34%	31.93%	NA
All Indica	2759	56.60%	5.90%	0.25%	37.30%	NA
All Japonica	1512	14.30%	55.60%	0.53%	29.63%	NA
Aus	269	11.90%	86.20%	0.37%	1.49%	NA
Indica I	595	72.60%	3.50%	0.50%	23.36%	NA
Indica II	465	40.20%	4.10%	0.00%	55.70%	NA
Indica III	913	61.00%	4.50%	0.33%	34.17%	NA
Indica Intermediate	786	49.00%	10.30%	0.13%	40.59%	NA
Temperate Japonica	767	6.00%	66.80%	0.52%	26.73%	NA
Tropical Japonica	504	21.20%	34.90%	0.60%	43.25%	NA
Japonica Intermediate	241	26.10%	63.10%	0.41%	10.37%	NA
VI/Aromatic	96	19.80%	79.20%	0.00%	1.04%	NA
Intermediate	90	28.90%	41.10%	0.00%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009642237	G -> A	LOC_Os10g18930.1	upstream_gene_variant ; 3791.0bp to feature; MODIFIER	silent_mutation	Average:38.916; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg1009642237	G -> A	LOC_Os10g18940.1	downstream_gene_variant ; 1534.0bp to feature; MODIFIER	silent_mutation	Average:38.916; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg1009642237	G -> A	LOC_Os10g18930-LOC_Os10g18940	intergenic_region ; MODIFIER	silent_mutation	Average:38.916; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N
vg1009642237	G -> DEL	N	N	silent_mutation	Average:38.916; most accessible tissue: Minghui63 young leaf, score: 54.11	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009642237	5.29E-06	NA	mr1403	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009642237	NA	1.95E-06	mr1691	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009642237	NA	9.34E-07	mr1772	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251