Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009283521:

Variant ID: vg1009283521 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9283521
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTGTGAAGTGATATATTTCATATTAATTTATATTGCTAATTTTTTATATATTTTTTGTGACTATTTAGATGATATGTACGAAACGAGGGGATATCCTC[C/T]
AGAGATGAATTCACTTTCCCCTGCTAGATGTTGCTTCACAGATCGACCTTGGGCGGCTGGTGCTGCTAGCTGCTTGACAGGAGGGGCAGATGAAACTGGC

Reverse complement sequence

GCCAGTTTCATCTGCCCCTCCTGTCAAGCAGCTAGCAGCACCAGCCGCCCAAGGTCGATCTGTGAAGCAACATCTAGCAGGGGAAAGTGAATTCATCTCT[G/A]
GAGGATATCCCCTCGTTTCGTACATATCATCTAAATAGTCACAAAAAATATATAAAAAATTAGCAATATAAATTAATATGAAATATATCACTTCACAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 5.40% 0.38% 0.00% NA
All Indica  2759 98.90% 1.10% 0.00% 0.00% NA
All Japonica  1512 97.80% 1.10% 1.06% 0.00% NA
Aus  269 38.30% 61.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 3.10% 0.00% 0.00% NA
Temperate Japonica  767 96.20% 1.70% 2.09% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 65.60% 32.30% 2.08% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009283521 C -> T LOC_Os10g18260.1 upstream_gene_variant ; 2878.0bp to feature; MODIFIER silent_mutation Average:63.18; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N
vg1009283521 C -> T LOC_Os10g18260-LOC_Os10g18294 intergenic_region ; MODIFIER silent_mutation Average:63.18; most accessible tissue: Zhenshan97 young leaf, score: 79.507 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1009283521 C T -0.03 -0.05 -0.06 -0.01 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009283521 NA 2.39E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 NA 9.09E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 NA 1.18E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 8.03E-06 1.07E-22 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 NA 2.93E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 NA 4.44E-26 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 NA 1.53E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 NA 4.79E-07 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 NA 6.60E-15 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 NA 1.13E-10 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 NA 2.27E-25 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 NA 4.72E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 NA 1.72E-13 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 NA 1.26E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 NA 7.81E-07 mr1738 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 1.21E-07 3.72E-23 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 NA 1.89E-14 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 3.77E-08 4.25E-08 mr1559_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 2.04E-07 3.25E-10 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009283521 NA 5.55E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251