Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009165657:

Variant ID: vg1009165657 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9165657
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTAATGCTCCATACATGTGTTTAAAGATTCGATGTGACGTTTTTGGGAAAAAAAAATTGGGGAACTAAACCGGGCCTAAATAGGCATACACAAAATGA[T/G]
AAAGCCATTCGCGTATGATTAAAATTTAGTTTAGTTATTACAAACTTAAAAATGGATTTATTTGATATTTTAAAATAACTTATATATAAAAAGTTTTCAC

Reverse complement sequence

GTGAAAACTTTTTATATATAAGTTATTTTAAAATATCAAATAAATCCATTTTTAAGTTTGTAATAACTAAACTAAATTTTAATCATACGCGAATGGCTTT[A/C]
TCATTTTGTGTATGCCTATTTAGGCCCGGTTTAGTTCCCCAATTTTTTTTTCCCAAAAACGTCACATCGAATCTTTAAACACATGTATGGAGCATTAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.60%	17.40%	0.04%	0.00%	NA
All Indica	2759	99.40%	0.60%	0.00%	0.00%	NA
All Japonica	1512	47.90%	52.00%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.90%	0.00%	0.00%	NA
Temperate Japonica	767	21.50%	78.20%	0.26%	0.00%	NA
Tropical Japonica	504	89.90%	10.10%	0.00%	0.00%	NA
Japonica Intermediate	241	44.00%	56.00%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009165657	T -> G	LOC_Os10g18084.1	upstream_gene_variant ; 4240.0bp to feature; MODIFIER	silent_mutation	Average:37.086; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1009165657	T -> G	LOC_Os10g18070.1	downstream_gene_variant ; 835.0bp to feature; MODIFIER	silent_mutation	Average:37.086; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1009165657	T -> G	LOC_Os10g18080.1	downstream_gene_variant ; 1368.0bp to feature; MODIFIER	silent_mutation	Average:37.086; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1009165657	T -> G	LOC_Os10g18070-LOC_Os10g18080	intergenic_region ; MODIFIER	silent_mutation	Average:37.086; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009165657	NA	5.26E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657	NA	3.87E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657	1.03E-09	5.25E-25	mr1768	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657	NA	9.31E-07	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657	NA	2.16E-31	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657	NA	1.68E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657	NA	7.47E-07	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657	NA	2.31E-18	mr1682_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657	NA	1.67E-31	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009165657	NA	9.13E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251