Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009008682:

Variant ID: vg1009008682 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9008682
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


AACCCTATAAAGAAGCAATAACAATACATAAAAAGAAAAGCACAAGGTTCTTTAGGTTATAACAAACATTAAAAGACTTGAACGGGTCGATTCGGAGTTC[G/T,A]
TATGACCAAGATATGGTCATCCGAAGTTTAATGCTGTTACATGGAGATTTACGGATTATTGTAATTAGGTTTTACAACTATAAAACATGTGTAAGTGCTA

Reverse complement sequence

TAGCACTTACACATGTTTTATAGTTGTAAAACCTAATTACAATAATCCGTAAATCTCCATGTAACAGCATTAAACTTCGGATGACCATATCTTGGTCATA[C/A,T]
GAACTCCGAATCGACCCGTTCAAGTCTTTTAATGTTTGTTATAACCTAAAGAACCTTGTGCTTTTCTTTTTATGTATTGTTATTGCTTCTTTATAGGGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.40% 24.50% 0.04% 0.00% NA
All Indica  2759 65.10% 34.80% 0.07% 0.00% NA
All Japonica  1512 89.60% 10.40% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 13.60% 86.40% 0.00% 0.00% NA
Indica II  465 83.70% 16.10% 0.22% 0.00% NA
Indica III  913 85.00% 15.00% 0.00% 0.00% NA
Indica Intermediate  786 70.00% 29.90% 0.13% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 72.80% 27.20% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009008682 G -> T LOC_Os10g17800.1 downstream_gene_variant ; 1782.0bp to feature; MODIFIER silent_mutation Average:38.356; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1009008682 G -> T LOC_Os10g17810.1 intron_variant ; MODIFIER silent_mutation Average:38.356; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1009008682 G -> A LOC_Os10g17800.1 downstream_gene_variant ; 1782.0bp to feature; MODIFIER N Average:38.356; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1009008682 G -> A LOC_Os10g17810.1 intron_variant ; MODIFIER N Average:38.356; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009008682 1.03E-10 NA mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 1.86E-14 2.68E-26 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 7.33E-08 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 2.82E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 1.11E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 3.14E-09 8.65E-21 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 1.16E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 2.35E-10 NA mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 1.05E-14 8.24E-25 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 2.20E-06 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 5.81E-09 3.25E-25 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 1.36E-10 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 3.79E-06 NA mr1580 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 7.34E-06 8.25E-12 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 6.38E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 3.97E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 1.58E-12 4.65E-30 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 2.27E-08 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 3.23E-08 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 6.59E-09 NA mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 7.04E-11 2.01E-23 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 2.11E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 5.24E-12 1.21E-31 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 6.23E-12 mr1496_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 8.30E-08 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 4.18E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 2.97E-15 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 8.37E-06 3.60E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 7.18E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 1.50E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 8.09E-11 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009008682 NA 4.67E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251